Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of DYNLRB1-dynein, light chain, roadblock-type 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DYNLRB1-dynein, light chain, roadblock-type 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002481 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DYNLRB1 |
| Origin species: | Human |
| Product name: | DYNLRB1-dynein, light chain, roadblock-type 1 Gene |
| Size: | 2ug |
| Accessions: | BC002481 |
| Gene id: | 83658 |
| Gene description: | dynein, light chain, roadblock-type 1 |
| Synonyms: | BITH; BLP; DNCL2A; DNLC2A; ROBLD1; dynein light chain roadblock-type 1; ROBL/LC7-like 1; bithoraxoid-like protein; dynein, cytoplasmic, light polypeptide 2A; dynein-associated protein Km23; roadblock domain-containing protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcagaggtggaggagacactgaagcgactgcagagccagaagggagtgcagggaatcatcgtcgtgaacacagaaggcattcccatcaagagcaccatggacaaccccaccaccacccagtatgccagcctcatgcacagcttcatcctgaaggcacggagcaccgtgcgtgacatcgacccccagaacgatctcaccttccttcgaattcgctccaagaaaaatgaaattatggttgcaccagataaagactatttcctgattgtgattcagaatccaaccgaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - synaptosomal-associated protein, 29kDa - ependymin related protein 1 (zebrafish) - HRAS-like suppressor family, member 5 - D4, zinc and double PHD fingers family 2 |