HIG2-hypoxia-inducible protein 2 Gene View larger

HIG2-hypoxia-inducible protein 2 Gene

PTXBC001863

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HIG2-hypoxia-inducible protein 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HIG2-hypoxia-inducible protein 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC001863
Product type: DNA & cDNA
Ncbi symbol: HIG2
Origin species: Human
Product name: HIG2-hypoxia-inducible protein 2 Gene
Size: 2ug
Accessions: BC001863
Gene id: 29923
Gene description: hypoxia-inducible protein 2
Synonyms: HIG2; C7orf68; HIG-2; hypoxia-inducible lipid droplet-associated protein; hypoxia inducible gene 2; hypoxia-inducible gene 2 protein; hypoxia-inducible protein 2; hypoxia inducible lipid droplet associated
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcatgtgttgaacctctacctgttaggtgtggtactgaccctactctccatcttcgttagagtgatggagtccctagagggcttactagagagcccatcgcctgggacctcctggaccaccagaagccaactagccaacacagagcccaccaagggccttccagaccatccatccagaagcatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypothetical LOC554207
- hypothetical LOC554202
- kelch domain containing 9
- hypothetical LOC389458

Buy HIG2-hypoxia-inducible protein 2 Gene now

Add to cart