Login to display prices
Login to display prices
HIG2-hypoxia-inducible protein 2 Gene View larger

HIG2-hypoxia-inducible protein 2 Gene

PTXBC001863

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HIG2-hypoxia-inducible protein 2 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about HIG2-hypoxia-inducible protein 2 Gene

Proteogenix catalog: PTXBC001863
Ncbi symbol: HIG2
Product name: HIG2-hypoxia-inducible protein 2 Gene
Size: 2ug
Accessions: BC001863
Gene id: 29923
Gene description: hypoxia-inducible protein 2
Synonyms: HIG2; C7orf68; HIG-2; hypoxia-inducible lipid droplet-associated protein; hypoxia inducible gene 2; hypoxia-inducible gene 2 protein; hypoxia-inducible protein 2; hypoxia inducible lipid droplet associated
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcatgtgttgaacctctacctgttaggtgtggtactgaccctactctccatcttcgttagagtgatggagtccctagagggcttactagagagcccatcgcctgggacctcctggaccaccagaagccaactagccaacacagagcccaccaagggccttccagaccatccatccagaagcatgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: