FAM165B-family with sequence similarity 165, member B Gene View larger

FAM165B-family with sequence similarity 165, member B Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of FAM165B-family with sequence similarity 165, member B Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about FAM165B-family with sequence similarity 165, member B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC015596
Product type: DNA & cDNA
Ncbi symbol: FAM165B
Origin species: Human
Product name: FAM165B-family with sequence similarity 165, member B Gene
Size: 2ug
Accessions: BC015596
Gene id: 54065
Gene description: family with sequence similarity 165, member B
Synonyms: protein FAM165B; FAM165B; C21orf51; SMIM11; SMIM11B; small integral membrane protein 11A; family with sequence similarity 165, member B; small integral membrane protein 11
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaattggaaggttcttgagcacgtgcccctgctgctgtatatcttggcagcaaaaacattaattctctgcctgacatttgctggggtgaaaatgtatcaaagaaaaaggttggaggcaaaacaacaaaaactggaggctgaaaggaagaagcaatcagagaaaaaagataactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - stimulated by retinoic acid 13 homolog (mouse)
- CDKN2A interacting protein N-terminal like
- ubiquinol-cytochrome c reductase, 6.4kDa subunit
- high-mobility group nucleosome binding domain 1

Buy FAM165B-family with sequence similarity 165, member B Gene now

Add to cart