Cart 21 Product Products 10 145,04 € (empty)
-
-
1 x FITC-Linke...180,32 € -
-
-
-
1 x C16orf70-c...121,50 € -
1 x ZSCAN20-zi...121,50 € -
-
1 x F2R-coagul...121,50 € -
1 x ZSCAN2-zin...113,40 € -
-
1 x TM7SF2-tra...121,50 € -
1 x C22orf25-c...121,50 € -
1 x PILRA-pair...113,40 € -
-
1 x TM7SF2-tra...121,50 € -
1 x FAM160B2-f...121,50 € -
-
-
1 x Biotin-Lin...180,32 € -
1 x FITC-Linke...48,02 €
No products
To be determined Shipping
10 145,04 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 21 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 10 145,04 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 10 145,04 €
View larger 
Data sheet of STRA13-stimulated by retinoic acid 13 homolog (mouse) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about STRA13-stimulated by retinoic acid 13 homolog (mouse) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC009571 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | STRA13 |
| Origin species: | Human |
| Product name: | STRA13-stimulated by retinoic acid 13 homolog (mouse) Gene |
| Size: | 2ug |
| Accessions: | BC009571 |
| Gene id: | 201254 |
| Gene description: | stimulated by retinoic acid 13 homolog (mouse) |
| Synonyms: | STRA13; CENP-X; FAAP10; MHF2; centromere protein X; FANCM associated histone fold protein 2; FANCM-interacting histone fold protein 2; Fanconi anemia-associated polypeptide of 10 kDa; retinoic acid-inducible gene D9 protein homolog; stimulated by retinoic acid 13 homolog; stimulated by retinoic acid gene 13 protein homolog |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagggagcaggagctggatccggcttccggaaggagctggtgagcaggctgctgcacctgcacttcaaggatgacaagaccaaagaagcagcagtccgtggcgtgcggcaggcccaggcagaagacgcgctccgtgcggacgtggaccagctggagaaggtgcttccgcagctgctcctggacttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CDKN2A interacting protein N-terminal like - ubiquinol-cytochrome c reductase, 6.4kDa subunit - high-mobility group nucleosome binding domain 1 - family with sequence similarity 119, member A |