STRA13-stimulated by retinoic acid 13 homolog (mouse) Gene View larger

STRA13-stimulated by retinoic acid 13 homolog (mouse) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of STRA13-stimulated by retinoic acid 13 homolog (mouse) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about STRA13-stimulated by retinoic acid 13 homolog (mouse) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009571
Product type: DNA & cDNA
Ncbi symbol: STRA13
Origin species: Human
Product name: STRA13-stimulated by retinoic acid 13 homolog (mouse) Gene
Size: 2ug
Accessions: BC009571
Gene id: 201254
Gene description: stimulated by retinoic acid 13 homolog (mouse)
Synonyms: STRA13; CENP-X; FAAP10; MHF2; centromere protein X; FANCM associated histone fold protein 2; FANCM-interacting histone fold protein 2; Fanconi anemia-associated polypeptide of 10 kDa; retinoic acid-inducible gene D9 protein homolog; stimulated by retinoic acid 13 homolog; stimulated by retinoic acid gene 13 protein homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagggagcaggagctggatccggcttccggaaggagctggtgagcaggctgctgcacctgcacttcaaggatgacaagaccaaagaagcagcagtccgtggcgtgcggcaggcccaggcagaagacgcgctccgtgcggacgtggaccagctggagaaggtgcttccgcagctgctcctggacttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CDKN2A interacting protein N-terminal like
- ubiquinol-cytochrome c reductase, 6.4kDa subunit
- high-mobility group nucleosome binding domain 1
- family with sequence similarity 119, member A

Buy STRA13-stimulated by retinoic acid 13 homolog (mouse) Gene now

Add to cart