UQCR-ubiquinol-cytochrome c reductase, 6.4kDa subunit Gene View larger

UQCR-ubiquinol-cytochrome c reductase, 6.4kDa subunit Gene

PTXBC000462

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UQCR-ubiquinol-cytochrome c reductase, 6.4kDa subunit Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UQCR-ubiquinol-cytochrome c reductase, 6.4kDa subunit Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000462
Product type: DNA & cDNA
Ncbi symbol: UQCR
Origin species: Human
Product name: UQCR-ubiquinol-cytochrome c reductase, 6.4kDa subunit Gene
Size: 2ug
Accessions: BC000462
Gene id: 10975
Gene description: ubiquinol-cytochrome c reductase, 6.4kDa subunit
Synonyms: UQCR; 0710008D09Rik; QCR10; cytochrome b-c1 complex subunit 10; complex III subunit 10; complex III subunit XI; ubiquinol-cytochrome c reductase complex 6.4 kDa protein; ubiquinol-cytochrome c reductase, 6.4kDa subunit; ubiquinol-cytochrome c reductase, complex III subunit XI
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggtgacccggttcctgggcccacgctaccgggagctggtcaagaactgggtcccgacggcctacacatggggcgctgtgggcgccgtggggctggtgtgggccaccgattggcggctgatcctggactgggtaccttacatcaatggcaagtttaagaaggataattaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - high-mobility group nucleosome binding domain 1
- family with sequence similarity 119, member A
- family with sequence similarity 71, member F1
- ras homolog gene family, member F (in filopodia)

Buy UQCR-ubiquinol-cytochrome c reductase, 6.4kDa subunit Gene now

Add to cart