Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of UQCR-ubiquinol-cytochrome c reductase, 6.4kDa subunit Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UQCR-ubiquinol-cytochrome c reductase, 6.4kDa subunit Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000462 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UQCR |
| Origin species: | Human |
| Product name: | UQCR-ubiquinol-cytochrome c reductase, 6.4kDa subunit Gene |
| Size: | 2ug |
| Accessions: | BC000462 |
| Gene id: | 10975 |
| Gene description: | ubiquinol-cytochrome c reductase, 6.4kDa subunit |
| Synonyms: | UQCR; 0710008D09Rik; QCR10; cytochrome b-c1 complex subunit 10; complex III subunit 10; complex III subunit XI; ubiquinol-cytochrome c reductase complex 6.4 kDa protein; ubiquinol-cytochrome c reductase, 6.4kDa subunit; ubiquinol-cytochrome c reductase, complex III subunit XI |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggtgacccggttcctgggcccacgctaccgggagctggtcaagaactgggtcccgacggcctacacatggggcgctgtgggcgccgtggggctggtgtgggccaccgattggcggctgatcctggactgggtaccttacatcaatggcaagtttaagaaggataattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - high-mobility group nucleosome binding domain 1 - family with sequence similarity 119, member A - family with sequence similarity 71, member F1 - ras homolog gene family, member F (in filopodia) |