Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of HMGN1-high-mobility group nucleosome binding domain 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about HMGN1-high-mobility group nucleosome binding domain 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC000075 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | HMGN1 |
| Origin species: | Human |
| Product name: | HMGN1-high-mobility group nucleosome binding domain 1 Gene |
| Size: | 2ug |
| Accessions: | BC000075 |
| Gene id: | 3150 |
| Gene description: | high-mobility group nucleosome binding domain 1 |
| Synonyms: | HMG14; non-histone chromosomal protein HMG-14; high mobility group nucleosome-binding domain-containing protein 1; high-mobility group (nonhistone chromosomal) protein 14; high-mobility group nucleosome binding 1; nonhistone chromosomal protein HMG-14; high mobility group nucleosome binding domain 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccaagaggaaggtcagctccgccgaaggcgccgccaaggaagagcccaagaggagatcggcgcggttgtcagctaaacctcctgcaaaagtggaagcgaagccgaaaaaggcagcagcgaaggataaatcttcagacaaaaaagtgcaaacaaaagggaaaaggggagcaaagggaaaacaggccgaagtggctaaccaagaaactaaagaagacttacctgcggaaaacggggaaacgaagactgaggagagtccagcctctgatgaagcaggagagaaagaagccaagtctgattaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 119, member A - family with sequence similarity 71, member F1 - ras homolog gene family, member F (in filopodia) - family with sequence similarity 133, member B |