Login to display prices
Login to display prices
SBDSP-Shwachman-Bodian-Diamond syndrome pseudogene Gene View larger

SBDSP-Shwachman-Bodian-Diamond syndrome pseudogene Gene

PTXBC010183

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SBDSP-Shwachman-Bodian-Diamond syndrome pseudogene Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SBDSP-Shwachman-Bodian-Diamond syndrome pseudogene Gene

Proteogenix catalog: PTXBC010183
Ncbi symbol: SBDSP
Product name: SBDSP-Shwachman-Bodian-Diamond syndrome pseudogene Gene
Size: 2ug
Accessions: BC010183
Gene id: 155370
Gene description: Shwachman-Bodian-Diamond syndrome pseudogene
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcgatcttcacccccaccaaccagatccgcctaaccaatgtggccgtggtacggatgaagcgcgccaggaagcgcttcgaaatcgcctgctacagaaacaaggtcgtcggctggcggagcggcttggaaaaagaccttgatgaagttctgcagacccactcagtgtttgtaaatgtttcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: