Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
Data sheet of TMSB4Y-thymosin beta 4, Y-linked Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about TMSB4Y-thymosin beta 4, Y-linked Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC022482 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | TMSB4Y |
| Origin species: | Human |
| Product name: | TMSB4Y-thymosin beta 4, Y-linked Gene |
| Size: | 2ug |
| Accessions: | BC022482 |
| Gene id: | 9087 |
| Gene description: | thymosin beta 4, Y-linked |
| Synonyms: | TB4Y; thymosin beta-4, Y-chromosomal; thymosin beta-4, Y isoform; thymosin, beta 4, Y chromosome; thymosin beta 4, Y-linked |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctgacaaacctggtatggctgagatcgagaaattcgataagtcgaaactgaagaagacagaaacgcaagagaagaatccattgtcttccaaagaaactatcgaacaggagaggcaagcaggcgaatcttaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - hypoxia-inducible protein 2 - hypothetical LOC554207 - hypothetical LOC554202 - kelch domain containing 9 |