TMSB4Y-thymosin beta 4, Y-linked Gene View larger

TMSB4Y-thymosin beta 4, Y-linked Gene

PTXBC022482

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of TMSB4Y-thymosin beta 4, Y-linked Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about TMSB4Y-thymosin beta 4, Y-linked Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC022482
Product type: DNA & cDNA
Ncbi symbol: TMSB4Y
Origin species: Human
Product name: TMSB4Y-thymosin beta 4, Y-linked Gene
Size: 2ug
Accessions: BC022482
Gene id: 9087
Gene description: thymosin beta 4, Y-linked
Synonyms: TB4Y; thymosin beta-4, Y-chromosomal; thymosin beta-4, Y isoform; thymosin, beta 4, Y chromosome; thymosin beta 4, Y-linked
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtctgacaaacctggtatggctgagatcgagaaattcgataagtcgaaactgaagaagacagaaacgcaagagaagaatccattgtcttccaaagaaactatcgaacaggagaggcaagcaggcgaatcttaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - hypoxia-inducible protein 2
- hypothetical LOC554207
- hypothetical LOC554202
- kelch domain containing 9

Buy TMSB4Y-thymosin beta 4, Y-linked Gene now

Add to cart