No products
Prices are tax excluded
New product
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC006282 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | VPS25 |
| Origin species: | Human |
| Product name: | VPS25-vacuolar protein sorting 25 homolog (S. cerevisiae) Gene |
| Size: | 2ug |
| Accessions: | BC006282 |
| Gene id: | 84313 |
| Gene description: | vacuolar protein sorting 25 homolog (S. cerevisiae) |
| Synonyms: | ESCRT-II complex subunit VPS25; DERP9; FAP20; vacuolar protein-sorting-associated protein 25; ELL-associated protein of 20 kDa; dermal papilla-derived protein 9; vacuolar protein sorting 25 homolog |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcgatgagtttcgagtggccgtggcagtatcgcttcccacccttctttacgttacaaccgaatgtggacactcggcagaagcagctggccgcctggtgctcgctggtcctgtccttctgccgcctgcacaaacagtccagcatgacggtgatggaagctcaggagagcccgctcttcaacaacgtcaagctacagcgaaagcttcctgtggagtcgatccagattgtattagaggaactgaggaagaaagggaacctcgagtggttggataagagcaagtccagcttcctgatcatgtggcggaggccagaagaatgggggaaactcatctatcagtgggtttccaggagtggccagaacaactccgtctttaccctgtatgaactgactaatggggaagacacagaggatgaggagttccacgggctggatgaagccactctactgcgggctctgcaggccctacagcaggagcacaaggccgagatcatcactgtcagcgatggccgaggcgtcaagttcttctag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - uncoupling protein 3 (mitochondrial, proton carrier) - DMRT-like family B with proline-rich C-terminal, 1 - integrin beta 3 binding protein (beta3-endonexin) - vacuolar protein sorting 45 homolog (S. cerevisiae) |