VPS45-vacuolar protein sorting 45 homolog (S. cerevisiae) Gene View larger

VPS45-vacuolar protein sorting 45 homolog (S. cerevisiae) Gene


New product

Data sheet of VPS45-vacuolar protein sorting 45 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about VPS45-vacuolar protein sorting 45 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC012932
Product type: DNA & cDNA
Ncbi symbol: VPS45
Origin species: Human
Product name: VPS45-vacuolar protein sorting 45 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC012932
Gene id: 11311
Gene description: vacuolar protein sorting 45 homolog (S. cerevisiae)
Synonyms: H1VPS45; SCN5; VPS45A; VPS45B; VPS54A; VSP45; VSP45A; vacuolar protein sorting-associated protein 45; hlVps45; leucocyte vacuolar protein sorting 45; vacuolar protein sorting 45A; vacuolar protein sorting 45 homolog
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacgtggtttttgctgtgaagcagtacatttccaaaatgatagaggacagcgggcctggtatgaaagtacttctcatggataaagagacgactggcatagtgagtatggtatacacacaatcggagattctacagaaggaagtgtacctctttgaacgcattgattctcaaaatcgagagatcatgaaacacctgaaggcaatttgttttcttcgacctacaaaggagaatgtggattatattattcaggagctccgaagacccaaatacactatatatttcatttatttcagtaatgtgatcagcaagagtgacgtgaagtcattggctgaagctgatgaacaggaagttgtggctgaggttcaggaattttatggtgattacattgctgtgaacccacatttgttttccctcaatattttgggttgctgccagggtcgaaattgggatccagcccagctatctagaacaactcaagggcttacagctctccttttatctctgaagaagtgtcccatgattcgttatcagctctcatcagaggcagcaaagagacttgcagagtgcgttaagcaagtgataactaaagaatatgaactgtttgaattccgtcggacagaggttcctccattgctccttattttagatcgctgtgatgatgccatcaccccattgctaaaccagtggacatatcaggccatggtccacgaactactaggcataaacaacaatcggattgatctttccagagtgccgggaatcagtaaagacttaagagaagtggtcctatctgctgaaaatgatgaattctatgctaataatatgtacctgaactttgctgagattggtagcaatataaagaatctcatggaagattttcagaagaagaaaccaaaagaacagcaaaaactagaatcaatagcagacatgaaggcgtttgttgagaattatccacagttcaagaaaatgtctgggactgtttcaaagcatgtgacagtggttggagaactgtctcgattggtcagtgaacggaatctgctggaggtttcagaggttgagcaagaactggcctgtcaaaatgaccattctagtgctctccagaatataaaaaggcttctgcagaaccccaaagtgacagagtttgatgctgcccgcctggtgatgctttatgctttacattatgagcgacacagcagcaatagcctgccaggactaatgatggacctcaggaataaaggtgtttctgagaagtatcgaaagctcgtgtctgcagttgttgaatatggtggtaaacgagtcagaggaagtgacctcttcagccccaaagatgctgtggctatcaccaaacaattcctcaaaggactgaagggagtagaaaatgtatatacacagcatcaacctttcctacatgaaaccctggatcatctcatcaaaggaaggcttaaggaaaacctatatccttatttaggccccagcacactcagagacagacctcaggatatcattgtgtttgtaattggaggagccacctatgaagaggctctaacagtttataacctgaaccgcaccactcctggagtgaggattgtcctgggaggcaccacagtgcacaacacgaaaagtttcctagaggaagttctggcttctggactgcacagccgaagcaaggagagctctcaagtcacatcaaggtcagcgagcagaagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - heterogeneous nuclear ribonucleoprotein U-like 1
- vacuolar protein sorting 39 homolog (S. cerevisiae)
- epidermal growth factor receptor pathway substrate 8
- heterogeneous nuclear ribonucleoprotein U-like 1

Buy VPS45-vacuolar protein sorting 45 homolog (S. cerevisiae) Gene now

Add to cart