Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
DMRTB1-DMRT-like family B with proline-rich C-terminal, 1 Gene
PTXBC029566
New product
Data sheet of DMRTB1-DMRT-like family B with proline-rich C-terminal, 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about DMRTB1-DMRT-like family B with proline-rich C-terminal, 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC029566 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | DMRTB1 |
| Origin species: | Human |
| Product name: | DMRTB1-DMRT-like family B with proline-rich C-terminal, 1 Gene |
| Size: | 2ug |
| Accessions: | BC029566 |
| Gene id: | 63948 |
| Gene description: | DMRT-like family B with proline-rich C-terminal, 1 |
| Synonyms: | doublesex- and mab-3-related transcription factor B1; DMRT like family B with proline rich C-terminal 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgcccagccttgcgggacccccttttggggcggaggccgcaggcagtggctaccctggccccctagacctgcgcaggccgatgcggaccgtgcccggcccactgttcaccgactttgtgcgccctctgaacatcaacccggaccgtgcactgggccctgagtaccctggtggctccagcatgcacccctactgcccgttcccgctgggctacctggacgcccctcctggcgtccccctgcagcagggcttccggcatgtgtcccgcagccagtaccaaggcggaggcttggtgtcagaaccaggaggagacttccagccaagctactacctgccgccgccgccgccgccactgccgccccttccaccgcttccaccgcagccccagttcctcccgccaggctacctctctgcgctccacttcctccccccgccaccgccaccaccacctccatcatctttctcactgaccgtcctgtttgatactgacaaggagaacactgatgaccaggatgcagaggtactgtcgggtgagcccagccagccatcgtctcaggagcagtccgactag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - integrin beta 3 binding protein (beta3-endonexin) - vacuolar protein sorting 45 homolog (S. cerevisiae) - heterogeneous nuclear ribonucleoprotein U-like 1 - vacuolar protein sorting 39 homolog (S. cerevisiae) |