Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
UCP3-uncoupling protein 3 (mitochondrial, proton carrier) Gene
PTXBC008392
New product
Data sheet of UCP3-uncoupling protein 3 (mitochondrial, proton carrier) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about UCP3-uncoupling protein 3 (mitochondrial, proton carrier) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC008392 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | UCP3 |
| Origin species: | Human |
| Product name: | UCP3-uncoupling protein 3 (mitochondrial, proton carrier) Gene |
| Size: | 2ug |
| Accessions: | BC008392 |
| Gene id: | 7352 |
| Gene description: | uncoupling protein 3 (mitochondrial, proton carrier) |
| Synonyms: | SLC25A9; mitochondrial uncoupling protein 3; solute carrier family 25 member 9; uncoupling protein 3 (mitochondrial, proton carrier); uncoupling protein 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggttggactgaagccttcagacgtgcctcccaccatggctgtgaagttcctgggggcaggcacagcagcctgttttgctgacctcgttacctttccactggacacagccaaggtccgcctgcagatccagggggagaaccaggcggtccagacggcccggctcgtgcagtaccgtggcgtgctgggcaccatcctgaccatggtgcggactgagggtccctgcagcccctacaatgggctggtggccggcctgcagcgccagatgagcttcgcctccatccgcatcggcctctacgactccgtcaagcaggtgtacacccccaaaggcgcggacaacttcccctgccactttgtctctgcctttggagccggcttctgtgccacagtggtggcctccccggtggacgtggtgaagacccggtatatgaactcacctccaggccagtacttcagccccctcgactgtatgataaagatggtggcccaggagggccccacagccttctacaagggatttacaccctcctttttgcgtttgggatcctggaacgtggtgatgttcgtaacctatgagcagctgaaacgggccctgatgaaagtccagatgttacgggaatcaccgttttga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DMRT-like family B with proline-rich C-terminal, 1 - integrin beta 3 binding protein (beta3-endonexin) - vacuolar protein sorting 45 homolog (S. cerevisiae) - heterogeneous nuclear ribonucleoprotein U-like 1 |