HNRNPUL1-heterogeneous nuclear ribonucleoprotein U-like 1 Gene View larger

HNRNPUL1-heterogeneous nuclear ribonucleoprotein U-like 1 Gene


New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of HNRNPUL1-heterogeneous nuclear ribonucleoprotein U-like 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about HNRNPUL1-heterogeneous nuclear ribonucleoprotein U-like 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004242
Product type: DNA & cDNA
Ncbi symbol: HNRNPUL1
Origin species: Human
Product name: HNRNPUL1-heterogeneous nuclear ribonucleoprotein U-like 1 Gene
Size: 2ug
Accessions: BC004242
Gene id: 11100
Gene description: heterogeneous nuclear ribonucleoprotein U-like 1
Synonyms: E1B-AP5; E1BAP5; HNRPUL1; heterogeneous nuclear ribonucleoprotein U-like protein 1; E1B 55kDa associated protein 5; E1B-55 kDa-associated protein 5; adenovirus early region 1B-associated protein 5; heterogeneous nuclear ribonucleoprotein U like 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggatgtgcgccgtctgaaggtgaacgaacttcgcgaggagctgcagcgccgcggcctggacactcgaggcctcaaggccgagcttgctgagcggctgcaggcggcgttggaggccgaggagcctgacgacgagcgggagctcgacgccgacgacgaaccggggcgacccgggcacatcaacgaggaggccgagttacagccagccaccctacaaccagggaggttacagccagggctacacagccccaccgcctccacctccaccaccacctgcctacaactatgggagctacggcggttacaacccggccccctataccccaccgccaccccccaccgcacagacctaccctcagcccagctataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - cytochrome b5 type B (outer mitochondrial membrane)
- vacuolar protein sorting 25 homolog (S. cerevisiae)
- uncoupling protein 3 (mitochondrial, proton carrier)
- DMRT-like family B with proline-rich C-terminal, 1

Buy HNRNPUL1-heterogeneous nuclear ribonucleoprotein U-like 1 Gene now

Add to cart