RPRM-reprimo, TP53 dependent G2 arrest mediator candidate Gene View larger

RPRM-reprimo, TP53 dependent G2 arrest mediator candidate Gene

PTXBC002908

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RPRM-reprimo, TP53 dependent G2 arrest mediator candidate Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RPRM-reprimo, TP53 dependent G2 arrest mediator candidate Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002908
Product type: DNA & cDNA
Ncbi symbol: RPRM
Origin species: Human
Product name: RPRM-reprimo, TP53 dependent G2 arrest mediator candidate Gene
Size: 2ug
Accessions: BC002908
Gene id: 56475
Gene description: reprimo, TP53 dependent G2 arrest mediator candidate
Synonyms: REPRIMO; protein reprimo; candidate mediator of the p53 dependent G2 arrest; reprimo, TP53 dependant G2 arrest mediator candidate; reprimo, TP53 dependent G2 arrest mediator candidate
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaatccggccctaggcaaccagacggacgtggcgggcctgttcctggccaacagcagcgaggcgctggagcgagccgtgcgctgctgcacccaggcgtccgtggtgaccgacgacggcttcgcggagggaggcccggacgagcgtagcctgtacataatgcgcgtggtgcagatcgcggtcatgtgcgtgctctcactcaccgtggtcttcggcatcttcttcctcggctgcaatctgctcatcaagtccgagggcatgatcaacttcctcgtgaaggaccggaggccgtctaaggaggtggaggcggtggtcgtggggccctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - heterogeneous nuclear ribonucleoprotein U-like 1
- cytochrome b5 type B (outer mitochondrial membrane)
- vacuolar protein sorting 25 homolog (S. cerevisiae)
- uncoupling protein 3 (mitochondrial, proton carrier)

Buy RPRM-reprimo, TP53 dependent G2 arrest mediator candidate Gene now

Add to cart