Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
RPRM-reprimo, TP53 dependent G2 arrest mediator candidate Gene
PTXBC002908
New product
Data sheet of RPRM-reprimo, TP53 dependent G2 arrest mediator candidate Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RPRM-reprimo, TP53 dependent G2 arrest mediator candidate Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002908 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RPRM |
| Origin species: | Human |
| Product name: | RPRM-reprimo, TP53 dependent G2 arrest mediator candidate Gene |
| Size: | 2ug |
| Accessions: | BC002908 |
| Gene id: | 56475 |
| Gene description: | reprimo, TP53 dependent G2 arrest mediator candidate |
| Synonyms: | REPRIMO; protein reprimo; candidate mediator of the p53 dependent G2 arrest; reprimo, TP53 dependant G2 arrest mediator candidate; reprimo, TP53 dependent G2 arrest mediator candidate |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaatccggccctaggcaaccagacggacgtggcgggcctgttcctggccaacagcagcgaggcgctggagcgagccgtgcgctgctgcacccaggcgtccgtggtgaccgacgacggcttcgcggagggaggcccggacgagcgtagcctgtacataatgcgcgtggtgcagatcgcggtcatgtgcgtgctctcactcaccgtggtcttcggcatcttcttcctcggctgcaatctgctcatcaagtccgagggcatgatcaacttcctcgtgaaggaccggaggccgtctaaggaggtggaggcggtggtcgtggggccctactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - heterogeneous nuclear ribonucleoprotein U-like 1 - cytochrome b5 type B (outer mitochondrial membrane) - vacuolar protein sorting 25 homolog (S. cerevisiae) - uncoupling protein 3 (mitochondrial, proton carrier) |