Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
SCGB1A1-secretoglobin, family 1A, member 1 (uteroglobin) Gene
PTXBC004481
New product
Data sheet of SCGB1A1-secretoglobin, family 1A, member 1 (uteroglobin) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about SCGB1A1-secretoglobin, family 1A, member 1 (uteroglobin) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004481 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | SCGB1A1 |
| Origin species: | Human |
| Product name: | SCGB1A1-secretoglobin, family 1A, member 1 (uteroglobin) Gene |
| Size: | 2ug |
| Accessions: | BC004481 |
| Gene id: | 7356 |
| Gene description: | secretoglobin, family 1A, member 1 (uteroglobin) |
| Synonyms: | CC10; CC16; CCPBP; CCSP; UGB; UP-1; UP1; uteroglobin; blastokinin; clara cell phospholipid-binding protein; clara cells 10 kDa secretory protein; secretoglobin, family 1A, member 1 (uteroglobin); urinary protein 1; urine protein 1; secretoglobin family 1A member 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgaaactcgctgtcaccctcaccctggtcacactggctctctgctgcagctccgcttctgcagagatctgcccgagctttcagcgtgtcatcgaaaccctcctcatggacacaccctccagttatgaggctgccatggaacttttcagccctgatcaagacatgagggaggcaggggctcagctgaagaagctggtggacaccctcccccaaaagcccagagaaagcatcattaagctcatggaaaaaatagcccaaagctcactgtgtaattag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - polymerase (DNA directed), epsilon 3 (p17 subunit) - CKLF-like MARVEL transmembrane domain containing 5 - CKLF-like MARVEL transmembrane domain containing 6 - DnaJ (Hsp40) homolog, subfamily C, member 5 beta |