Login to display prices
Login to display prices
SCGB1A1-secretoglobin, family 1A, member 1 (uteroglobin) Gene View larger

SCGB1A1-secretoglobin, family 1A, member 1 (uteroglobin) Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SCGB1A1-secretoglobin, family 1A, member 1 (uteroglobin) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about SCGB1A1-secretoglobin, family 1A, member 1 (uteroglobin) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC004481
Product type: DNA & cDNA
Ncbi symbol: SCGB1A1
Origin species: Human
Product name: SCGB1A1-secretoglobin, family 1A, member 1 (uteroglobin) Gene
Size: 2ug
Accessions: BC004481
Gene id: 7356
Gene description: secretoglobin, family 1A, member 1 (uteroglobin)
Synonyms: CC10; CC16; CCPBP; CCSP; UGB; UP-1; UP1; uteroglobin; blastokinin; clara cell phospholipid-binding protein; clara cells 10 kDa secretory protein; secretoglobin, family 1A, member 1 (uteroglobin); urinary protein 1; urine protein 1; secretoglobin family 1A member 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaaactcgctgtcaccctcaccctggtcacactggctctctgctgcagctccgcttctgcagagatctgcccgagctttcagcgtgtcatcgaaaccctcctcatggacacaccctccagttatgaggctgccatggaacttttcagccctgatcaagacatgagggaggcaggggctcagctgaagaagctggtggacaccctcccccaaaagcccagagaaagcatcattaagctcatggaaaaaatagcccaaagctcactgtgtaattag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - polymerase (DNA directed), epsilon 3 (p17 subunit)
- CKLF-like MARVEL transmembrane domain containing 5
- CKLF-like MARVEL transmembrane domain containing 6
- DnaJ (Hsp40) homolog, subfamily C, member 5 beta