POLE3-polymerase (DNA directed), epsilon 3 (p17 subunit) Gene View larger

POLE3-polymerase (DNA directed), epsilon 3 (p17 subunit) Gene

PTXBC003166

New product

113,40 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of POLE3-polymerase (DNA directed), epsilon 3 (p17 subunit) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about POLE3-polymerase (DNA directed), epsilon 3 (p17 subunit) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC003166
Product type: DNA & cDNA
Ncbi symbol: POLE3
Origin species: Human
Product name: POLE3-polymerase (DNA directed), epsilon 3 (p17 subunit) Gene
Size: 2ug
Accessions: BC003166
Gene id: 54107
Gene description: polymerase (DNA directed), epsilon 3 (p17 subunit)
Synonyms: CHARAC17; CHRAC17; YBL1; p17; DNA polymerase epsilon subunit 3; CHRAC-17; DNA polymerase II subunit 3; DNA polymerase epsilon p17 subunit; DNA polymerase epsilon subunit p17; arsenic transactivated protein; asTP; chromatin accessibility complex 17 kDa protein; histone fold protein CHRAC17; huCHRAC17; polymerase (DNA directed), epsilon 3 (p17 subunit); polymerase (DNA directed), epsilon 3, accessory subunit; polymerase (DNA) epsilon 3, accessory subunit; DNA polymerase epsilon 3, accessory subunit
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcggagaggcccgaggacctaaacctgcccaatgccgtgatcaccaggatcatcaaggaggcgctcccggacggtgtcaacatctccaaggaggcccggagcgccatctcccgcgccgccagcgtcttcgtgctgtacgccacatcctgtgctaacaactttgcaatgaaaggaaagcggaagacgctgaatgccagtgatgtgctctcagccatggaagagatggagttccagcggttcgttaccccattgaaagaagctctggaagcatataggcgggagcagaaaggcaagaaggaggcctcagagcaaaagaagaaggacaaagacaaaaaaacagactcggaagagcaagacaagagcagggatgaggacaatgatgaagacgaagaaaggctggaagaagaagaacagaatgaagaggaagaagtagacaactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - CKLF-like MARVEL transmembrane domain containing 5
- CKLF-like MARVEL transmembrane domain containing 6
- DnaJ (Hsp40) homolog, subfamily C, member 5 beta
- OMA1 homolog, zinc metallopeptidase (S. cerevisiae)

Buy POLE3-polymerase (DNA directed), epsilon 3 (p17 subunit) Gene now

Add to cart