Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
POLE3-polymerase (DNA directed), epsilon 3 (p17 subunit) Gene
PTXBC003166
New product
Data sheet of POLE3-polymerase (DNA directed), epsilon 3 (p17 subunit) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about POLE3-polymerase (DNA directed), epsilon 3 (p17 subunit) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC003166 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | POLE3 |
| Origin species: | Human |
| Product name: | POLE3-polymerase (DNA directed), epsilon 3 (p17 subunit) Gene |
| Size: | 2ug |
| Accessions: | BC003166 |
| Gene id: | 54107 |
| Gene description: | polymerase (DNA directed), epsilon 3 (p17 subunit) |
| Synonyms: | CHARAC17; CHRAC17; YBL1; p17; DNA polymerase epsilon subunit 3; CHRAC-17; DNA polymerase II subunit 3; DNA polymerase epsilon p17 subunit; DNA polymerase epsilon subunit p17; arsenic transactivated protein; asTP; chromatin accessibility complex 17 kDa protein; histone fold protein CHRAC17; huCHRAC17; polymerase (DNA directed), epsilon 3 (p17 subunit); polymerase (DNA directed), epsilon 3, accessory subunit; polymerase (DNA) epsilon 3, accessory subunit; DNA polymerase epsilon 3, accessory subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggagaggcccgaggacctaaacctgcccaatgccgtgatcaccaggatcatcaaggaggcgctcccggacggtgtcaacatctccaaggaggcccggagcgccatctcccgcgccgccagcgtcttcgtgctgtacgccacatcctgtgctaacaactttgcaatgaaaggaaagcggaagacgctgaatgccagtgatgtgctctcagccatggaagagatggagttccagcggttcgttaccccattgaaagaagctctggaagcatataggcgggagcagaaaggcaagaaggaggcctcagagcaaaagaagaaggacaaagacaaaaaaacagactcggaagagcaagacaagagcagggatgaggacaatgatgaagacgaagaaaggctggaagaagaagaacagaatgaagaggaagaagtagacaactga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CKLF-like MARVEL transmembrane domain containing 5 - CKLF-like MARVEL transmembrane domain containing 6 - DnaJ (Hsp40) homolog, subfamily C, member 5 beta - OMA1 homolog, zinc metallopeptidase (S. cerevisiae) |