Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CMTM5-CKLF-like MARVEL transmembrane domain containing 5 Gene
PTXBC013109
New product
Data sheet of CMTM5-CKLF-like MARVEL transmembrane domain containing 5 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CMTM5-CKLF-like MARVEL transmembrane domain containing 5 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC013109 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CMTM5 |
| Origin species: | Human |
| Product name: | CMTM5-CKLF-like MARVEL transmembrane domain containing 5 Gene |
| Size: | 2ug |
| Accessions: | BC013109 |
| Gene id: | 116173 |
| Gene description: | CKLF-like MARVEL transmembrane domain containing 5 |
| Synonyms: | CKLFSF5; CKLF-like MARVEL transmembrane domain-containing protein 5; chemokine-like factor super family 5; chemokine-like factor superfamily member 5; CKLF like MARVEL transmembrane domain containing 5 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgctcagtgctcgagatcgccgggaccggcaccctgaggagggggtagttgcagagctccagggcttcgcggtggacaaggccttcctcacctcccacaagggcatcctgctggaaaccgagctggccctgaccctcatcatcttcatctgcttcacggcctccatctctgcctacatggccgcggcgctactggagttcttcatcacacttgccttcctcttcctctatgccacccagtactaccagcgcttcgaccgaattaactggccctgtctggacttcctgcgctgtgtcagtgccatcatcatcttcctggtggtctcctttgcagctgtgacctcccgggacggagctgccattgctgcttttgtttttggcatcatcctggtttccatctttgcctatgatgccttcaagatctaccggactgagatggcacccggggccagccagggggaccagcagtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - CKLF-like MARVEL transmembrane domain containing 6 - DnaJ (Hsp40) homolog, subfamily C, member 5 beta - OMA1 homolog, zinc metallopeptidase (S. cerevisiae) - SAC1 suppressor of actin mutations 1-like (yeast) |