Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
CMTM6-CKLF-like MARVEL transmembrane domain containing 6 Gene
PTXBC002797
New product
Data sheet of CMTM6-CKLF-like MARVEL transmembrane domain containing 6 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about CMTM6-CKLF-like MARVEL transmembrane domain containing 6 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC002797 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | CMTM6 |
| Origin species: | Human |
| Product name: | CMTM6-CKLF-like MARVEL transmembrane domain containing 6 Gene |
| Size: | 2ug |
| Accessions: | BC002797 |
| Gene id: | 54918 |
| Gene description: | CKLF-like MARVEL transmembrane domain containing 6 |
| Synonyms: | CKLFSF6; PRO2219; CKLF-like MARVEL transmembrane domain-containing protein 6; chemokine-like factor super family 6; chemokine-like factor superfamily 6; chemokine-like factor superfamily member 6; CKLF like MARVEL transmembrane domain containing 6 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagaacggagcggtgtacagccccactacggaggaggacccgggccccgccagaggcccccggagcggcctcgctgcctactttttcatgggccggctcccattgctccggcgcgttctcaagggcttgcagctgttgctgtctctgctggccttcatctgtgaagaagttgtatcacaatgtactttatgtggaggactttatttttttgagtttgtaagctgcagtgcctttcttctgagtctccttatactgattgtgtattgcactccattttatgagagagttgataccacaaaagtaaaatcatcggatttttatattactttgggaacaggatgtgtgtttttgttggcatccatcatttttgtttccacacatgacaggacttcagctgagattgctgcaattgtgtttggatttatagcaagttttatgttcctacttgactttatcactatgctgtatgaaaaacgacaggagtcccagctgagaaaacctgaaaataccactagggctgaagccctcactgagccacttaatgcctaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - DnaJ (Hsp40) homolog, subfamily C, member 5 beta - OMA1 homolog, zinc metallopeptidase (S. cerevisiae) - SAC1 suppressor of actin mutations 1-like (yeast) - adaptor-related protein complex 3, delta 1 subunit |