UBE2I-ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) Gene View larger

UBE2I-ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) Gene

PTXBC000427

New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of UBE2I-ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about UBE2I-ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000427
Product type: DNA & cDNA
Ncbi symbol: UBE2I
Origin species: Human
Product name: UBE2I-ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) Gene
Size: 2ug
Accessions: BC000427
Gene id: 7329
Gene description: ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast)
Synonyms: C358B7.1; P18; UBC9; SUMO-conjugating enzyme UBC9; SUMO-1-protein ligase; SUMO-protein ligase; ubiquitin carrier protein 9; ubiquitin carrier protein I; ubiquitin conjugating enzyme 9; ubiquitin conjugating enzyme E2I; ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast); ubiquitin-conjugating enzyme E2I (homologous to yeast UBC9); ubiquitin-conjugating enzyme UbcE2A; ubiquitin-like protein SUMO-1 conjugating enzyme; ubiquitin-protein ligase E2I; ubiquitin-protein ligase I; ubiquitin conjugating enzyme E2 I
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgtcggggatcgccctcagcagactcgcccaggagaggaaagcatggaggaaagaccacccatttggtttcgtggctgtcccaacaaaaaatcccgatggcacgatgaacctcatgaactgggagtgcgccattccaggaaagaaagggactccgtgggaaggaggcttgtttaaactacggatgcttttcaaagatgattatccatcttcgccaccaaaatgtaaattcgaaccaccattatttcacccgaatgtgtacccttcggggacagtgtgcctgtccatcttagaggaggacaaggactggaggccagccatcacaatcaaacagatcctattaggaatacaggaacttctaaatgaaccaaatatccaagacccagctcaagcagaggcctacacgatttactgccaaaacagagtggagtacgagaaaagggtccgagcacaagccaagaagtttgcgccctcataa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - iron-sulfur cluster assembly 2 homolog (S. cerevisiae)
- ADP-ribosylation factor-like 6 interacting protein 1
- membrane-bound transcription factor peptidase, site 1
- ATP-binding cassette, sub-family B (MDR/TAP), member 6

Buy UBE2I-ubiquitin-conjugating enzyme E2I (UBC9 homolog, yeast) Gene now

Add to cart