MBTPS1-membrane-bound transcription factor peptidase, site 1 Gene View larger

MBTPS1-membrane-bound transcription factor peptidase, site 1 Gene


New product

Data sheet of MBTPS1-membrane-bound transcription factor peptidase, site 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about MBTPS1-membrane-bound transcription factor peptidase, site 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC026330
Product type: DNA & cDNA
Ncbi symbol: MBTPS1
Origin species: Human
Product name: MBTPS1-membrane-bound transcription factor peptidase, site 1 Gene
Size: 2ug
Accessions: BC026330
Gene id: 8720
Gene description: membrane-bound transcription factor peptidase, site 1
Synonyms: PCSK8; S1P; SKI-1; membrane-bound transcription factor site-1 protease; endopeptidase S1P; proprotein convertase subtilisin/kexin type 8; site-1 protease; subtilisin/kexin isozyme-1; membrane bound transcription factor peptidase, site 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaagcttgtcaacatctggctgcttctgctcgtggttttgctctgtgggaagaaacatctgggcgacagactggaaaagaaatcttttgaaaaggccccatgccctggctgttcccacctgactttgaaggtggaattctcatcaacagttgtggaatatgaatatattgtggctttcaatggatactttacagccaaagctagaaattcatttatttcaagtgccctgaagagcagtgaagtagacaattggagaattatacctcgaaacaatccatccagtgactaccctagtgattttgaggtgattcagataaaagaaaaacagaaagcggggctgctaacacttgaagatcatccaaacatcaaacgggtcacgccccaacgaaaagtctttcgttccctcaagtatgctgaatctgaccccacagtaccctgcaatgaaacccggtggagccagaagtggcaatcatcacgtcccctgcgaagagccagcctctccctgggctctggcttctggcatgctacgggaaggcattcgagcagacggctgctgagagccatcccgcgccaggttgcccagacactgcaggcagatgtgctctggcagatgggatatacaggtgctaatgtaagagttgctgtttttgacactgggctgagcgagaagcatccccacttcaaaaatgtgaaggagagaaccaactggaccaacgagcgaacgctggacgatgggttgggccatggcacattcgtggcaggtgtgatagccagcatgagggagtgccaaggatttgctccagatgcagaacttcacattttcagggtctttaccaataatcaggtatcttacgcatcttggtttttggacgccttcaactatgccattttaaagaagatcgacgtgttaaacctcagcatcggcggcccggacttcatggatcatccgtttgttgacaaggtgtgggaattaacagctaacaatgtaatcatggtttctgctattggcaatgacggacctctttatggcactctgaataaccctgctgatcaaatggatgtgattggagtaggcggcattgactttgaagataacatcgcccgcttttcttcaaggggaatgactacctgggagctaccaggaggctacggtcgcatgaaacctgacattgtcacctatggtgctggcgtgcggggttctggcgtgaaaggggggtgccgggccctctcagggaccagtgttgcttctccagtggttgcaggtgctgtcaccttgttagtgagcacagtccagaagcgtgagctggtgaatcctgccagtatgaagcaggccctgatcgcgtcagcccggaggctccccggggtcaacatgtttgagcaaggccacggcaagctcgatctgctcagagcctatcagatcctcaacagctacaagccacaggcaagtttgagccccagctacatagatctgactgagtgtccctacatgtggccctactgctcccagcccatctactatggaggaatgccgacagttgttaatgtcaccatcctcaacggcatgggagtcacaggaagaattgtagataagcctgactggcagccctatttgccacagaacggagacaacattgaagttgccttctcctactcctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ATP-binding cassette, sub-family B (MDR/TAP), member 6
- budding uninhibited by benzimidazoles 1 homolog (yeast)
- ATP-binding cassette, sub-family B (MDR/TAP), member 7
- dodecenoyl-Coenzyme A delta isomerase (3,2 trans-enoyl-Coenzyme A isomerase)

Buy MBTPS1-membrane-bound transcription factor peptidase, site 1 Gene now

Add to cart