Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
ARL6IP1-ADP-ribosylation factor-like 6 interacting protein 1 Gene
PTXBC010281
New product
Data sheet of ARL6IP1-ADP-ribosylation factor-like 6 interacting protein 1 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about ARL6IP1-ADP-ribosylation factor-like 6 interacting protein 1 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC010281 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | ARL6IP1 |
| Origin species: | Human |
| Product name: | ARL6IP1-ADP-ribosylation factor-like 6 interacting protein 1 Gene |
| Size: | 2ug |
| Accessions: | BC010281 |
| Gene id: | 23204 |
| Gene description: | ADP-ribosylation factor-like 6 interacting protein 1 |
| Synonyms: | AIP1; ARL6IP; ARMER; SPG61; ADP-ribosylation factor-like protein 6-interacting protein 1; ADP-ribosylation factor GTPase 6 interacting protein 1; ADP-ribosylation factor-like 6 interacting protein 1; ARL-6-interacting protein 1; aip-1; apoptotic regulator in the membrane of the endoplasmic reticulum; ADP ribosylation factor like GTPase 6 interacting protein 1 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggcggagggagataatcgcagcaccaacctgctggctgcagagactgcaagtctggaagaacagctgcaaggatggggagaagtgatgctgatggctgataaagtcctccgatgggaaagagcctggtttccacctgccatcatgggtgtggtttctttggtgtttctgattatctactatctagatccatctgttctgtccggcgtttcctgttttgttatgtttttgtgcttggctgactaccttgttcccattctagcgcctagaatttttggctccaataaatggaccactgaacaacagcaaagattccatgaaatttgcagcaatctagtaaaaactcgacgcagagctgtgggttggtggaaacgcctcttcacactaaaggaagaaaaacctaagatgtacttcatgaccatgatcgtttcccttgctgcggttgcttgggtgggacaacaagtccacaacctgcttctcacctacctgatagtgacttccttactattgcttcctggactaaaccaacatggaatcattttgaagtacattggaatggccaagagggagataaacaaacttctcaaacaaaaagaaaagaaaaacgaatga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - membrane-bound transcription factor peptidase, site 1 - ATP-binding cassette, sub-family B (MDR/TAP), member 6 - budding uninhibited by benzimidazoles 1 homolog (yeast) - ATP-binding cassette, sub-family B (MDR/TAP), member 7 |