ISCA2-iron-sulfur cluster assembly 2 homolog (S. cerevisiae) Gene View larger

ISCA2-iron-sulfur cluster assembly 2 homolog (S. cerevisiae) Gene


New product

113,40 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ISCA2-iron-sulfur cluster assembly 2 homolog (S. cerevisiae) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ISCA2-iron-sulfur cluster assembly 2 homolog (S. cerevisiae) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC032893
Product type: DNA & cDNA
Ncbi symbol: ISCA2
Origin species: Human
Product name: ISCA2-iron-sulfur cluster assembly 2 homolog (S. cerevisiae) Gene
Size: 2ug
Accessions: BC032893
Gene id: 122961
Gene description: iron-sulfur cluster assembly 2 homolog (S. cerevisiae)
Synonyms: HBLD1; ISA2; MMDS4; c14_5557; iron-sulfur cluster assembly 2 homolog, mitochondrial; HESB-like domain-containing protein 1; iron-sulfur cluster assembly 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgccgcctgggggtcgtccctaacggccgcgacgcagagagcggtcactccctggccgaggggcaggctcctcacggcctccctgggaccccaggcgcgtcgggaggcgtcgtcctccagccccgaggccggcgaagggcagatctgcctcacagacagttgcgtccagaggcttttggaaatcaccgaagggtcagaattcctcaggctgcaagtggagggaggtggatgctccggattccaatacaaattttcactggatacagttatcaaccccgacgacagggtatttgaacagggtggggcaagagtggtggttgactctgatagcttggccttcgtgaaaggggcccaggtggacttcagccaagaactgatccgaagctcatttcaagtgttgaacaatcctcaagcacagcaaggctgctcctgtgggtcatctttctctatcaaactttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ADP-ribosylation factor-like 6 interacting protein 1
- membrane-bound transcription factor peptidase, site 1
- ATP-binding cassette, sub-family B (MDR/TAP), member 6
- budding uninhibited by benzimidazoles 1 homolog (yeast)

Buy ISCA2-iron-sulfur cluster assembly 2 homolog (S. cerevisiae) Gene now

Add to cart