Login to display prices
Login to display prices
IFT20-intraflagellar transport 20 homolog (Chlamydomonas) Gene View larger

IFT20-intraflagellar transport 20 homolog (Chlamydomonas) Gene

PTXBC002640

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of IFT20-intraflagellar transport 20 homolog (Chlamydomonas) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about IFT20-intraflagellar transport 20 homolog (Chlamydomonas) Gene

Proteogenix catalog: PTXBC002640
Ncbi symbol: IFT20
Product name: IFT20-intraflagellar transport 20 homolog (Chlamydomonas) Gene
Size: 2ug
Accessions: BC002640
Gene id: 90410
Gene description: intraflagellar transport 20 homolog (Chlamydomonas)
Synonyms: intraflagellar transport protein IFT20; intraflagellar transport protein 20 homolog; intraflagellar transport 20 homolog; intraflagellar transport 20
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccaaggacatcctgggtgaagcagggctacactttgatgaactgaacaagctgagggtgttggacccagaggttacccagcagaccatagagctgaaggaagagtgcaaagactttgtggacaaaattggccagtttcagaaaatagttggtggtttaattgagcttgttgatcaacttgcaaaagaagcagaaaatgaaaagatgaagagtcttgctgtgtcacccaggctggagtgcactggtgcaatctcggctcactgcaagctctgcctctcagattcaagcgattctcccacctcaccctcccgagtaggtgggactacaggccatcggtgctcggaacttgctcaaatctatagcaaagcagagagaagctcaacagcagcaacttcaagccctaatagcagaaaagaaaatgcagctagaaaggtatcgggttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: