Login to display prices
Login to display prices
RBM12B-RNA binding motif protein 12B Gene View larger

RBM12B-RNA binding motif protein 12B Gene

PTXBC039260

New product

Data sheet of RBM12B-RNA binding motif protein 12B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RBM12B-RNA binding motif protein 12B Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC039260
Ncbi symbol: RBM12B
Product name: RBM12B-RNA binding motif protein 12B Gene
Size: 2ug
Accessions: BC039260
Gene id: 389677
Gene description: RNA binding motif protein 12B
Synonyms: MGC:33837; RNA-binding protein 12B; RNA binding motif protein 12B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgtagtcatccgtttactggggcttccttttattgcggggcctgtggatattcgtcacttcttcacgggattgactattcctgatggaggagtgcatataattggaggggaaattggggaggcttttattatttttgcaacagatgaagatgcaagacgtgccataagtcgttcaggagggtttatcaaggattcatctgtagagctctttcttagtagcaaggcagaaatgcagaagactatagaaatgaaaagaactgatcgtgtaggaagagggcgtccaggatctgggacatcaggggttgacagcctgtctaattttattgagtctgttaaggaagaagcaagtaattctggatatggctcttcaattaatcaagatgctgggtttcatactaatggtacaggacatggtaatttaaggccaagaaagacaaggccattgaaggccgagaatccttacttgtttctacgaggtttgccttacctagtaaatgaagatgatgtacgtgtctttttctctggtttgtgcgtggatggagtaattttcttaaaacatcatgatggccgaaataatggtgatgccatagtaaaatttgcttcatgtgttgatgcttcaggaggtcttaaatgtcatagaagttttatgggttcaagatttatagaagtaatgcaaggatcagaacaacagtggattgagtttggtggtaatgcagttaaggagggtgacgttcttaggagatttgaagaacattctccaccaagaggaattaatgatagacattttcgaaaacggtctcattcaaaatctcccagaagaacacgttctcgttcccctcttggattttatgttcacttaaaaaatctgtccctcagtattgacgaaagagatttaagaaatttctttagaggtactgatctgactgatgaacagattaggtttttatataaagatgaaaatagaacaagatatgcctttgtgatgttcaagactctgaaagactataataccgctctgagtttacataagactgttttacaatatcgtccagttcatattgatccaatttctagaaaacaaatgctgaagttcattgcacgttatgaaaagaagagatcagggtcactagagagagataggcccggacatgtttcacaaaaatactctcaagaaggtaactctggccagaaactgtgcatctatataaggaattttccatttgatgttacaaaagttgaagtgcagaagttctttgcagactttcttcttgctgaggatgacatttacttgctttatgatgacaaaggtgttggtctgggagaagcattagtgaaatttaaatcagaagaacaggccatgaaagctgaacgtttaaaccgacgaagattcctagggacagaggtgttattaagacttatatctgaggcacaaatacaggagtttggtgtaaatttttctgtgatgtccagtgaaaaaatgcaagctcgctcacagtcacgtgagcgaggtgaccattcccatttatttgactcaaaagacccaccaatatactcagttggtgcttttgaaaactttagacatcagctagaggacttgaggcaactggataacttcaagcatccccagagggatttccggcagcctgacaggcaccctccagaagacttccgacactcctcagaggactttaggttccccccggaggacttcaggcactccccagaggacttcaggcgacctagggaggaagacttcaggcggccttctgaggaggacttcaggcgcccttgggaggaagatttcaggtgccctccggaggatgacttcaggcaccctagggaggaggactggaggagaccacctccagagcattttggcggcctcccccagagcacttccggcggccacccccagagcacttcaggcggccacccccagagcatttcaggcgcccgcccccggagcacttccggagaccgccccaggagcatttcaggcggccacctcaggagcatttcaggcgctcccgagaggaagatttcaggcacccaccagatgaagacttcaggggccctcctgatgaagactttaggcaccctcctgatgaggacttcaggagcccccaggaggaagattttagatgcccttctgatgaggacttcaggcagctcccagaggaagaccttagggaagctccggaggaggaccctagacttcctgacaattttagacctcctggtgaggattttaggagcccgcctgatgattttagaagtcaccgcccttttgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: