Login to display prices
Login to display prices
JTB-jumping translocation breakpoint Gene View larger

JTB-jumping translocation breakpoint Gene

PTXBC004239

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of JTB-jumping translocation breakpoint Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about JTB-jumping translocation breakpoint Gene

Proteogenix catalog: PTXBC004239
Ncbi symbol: JTB
Product name: JTB-jumping translocation breakpoint Gene
Size: 2ug
Accessions: BC004239
Gene id: 10899
Gene description: jumping translocation breakpoint
Synonyms: protein JTB; HJTB; HSPC222; PAR; hJT; jumping translocation breakpoint protein; prostate androgen-regulated protein; jumping translocation breakpoint
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcctggggctggcatttatctttcctttcagcaagcacctcaaatttgccatgctggctggtggaagagtttgtggtagcagaagagtgctctccatgctctaatttccgggctaaaactacccctgagtgtggtcccacaggatatgtagagaaaatcacatgcagctcatctaagagaaatgagttcaaaagctgccgctcagctttgatggaacaacgcttattttggaagttcgaaggggctgtcgtgtgtgtggccctgatcttcgcttgtcttgtcatcattcgtcagcgacaattggacagaaaggctctggaaaaggtccggaagcaaatcgagtccatatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: