Login to display prices
Login to display prices
KBTBD4-kelch repeat and BTB (POZ) domain containing 4 Gene View larger

KBTBD4-kelch repeat and BTB (POZ) domain containing 4 Gene


New product

Data sheet of KBTBD4-kelch repeat and BTB (POZ) domain containing 4 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about KBTBD4-kelch repeat and BTB (POZ) domain containing 4 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002736
Product type: DNA & cDNA
Ncbi symbol: KBTBD4
Origin species: Human
Product name: KBTBD4-kelch repeat and BTB (POZ) domain containing 4 Gene
Size: 2ug
Accessions: BC002736
Gene id: 55709
Gene description: kelch repeat and BTB (POZ) domain containing 4
Synonyms: BKLHD4; HSPC252; kelch repeat and BTB domain-containing protein 4; BTB and kelch domain containing 4; BTB and kelch domain-containing protein 4; kelch repeat and BTB (POZ) domain containing 4; kelch repeat and BTB domain containing 4
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaatcaccagaggagcctggagcatccatggatgagaactactttgtgaactacactttcaaagatcggtcacattcaggccgtgtggctcaaggcatcatgaaactgtgtctagaggaggagctctttgctgatgtcaccatttcggtggaaggccgggagtttcagctccatcggctggtcctctcagctcagagctgcttcttccgatccatgttcacttccaacctgaaggaggcccacaaccgggtgattgtgctgcaggatgtcagcgagtctgttttccagctcctggttgattatatctaccatgggactgtgaaacttcgagctgaggagttgcaggaaatttatgaggtgtcagacatgtatcagctgacatctctctttgaggaatgctctcggtttttggcccgcacagtgcaagtgggaaactgccttcaggtgatgtggctggcagatcggcacagtgatcctgagctctatacggctgccaagcactgtgccaagacccacctggcccagctgcagaatacagaggaatttctccacttgccccaccgcttactcacagatatcatctcggatggagttccgtgttctcagaacccaacagaggcaatagaagcctggatcaactttaataaagaggaaagagaggcttttgcagagtcactcaggacaagcttgaaggaaattggggagaatgtgcacatttacctgattgggaaagagtcatctcgtacccactcgttggctgtgtccttgcactgtgcagaagatgactccatcagtgtaagtggccaaaacagtttgtgccaccagatcactgcggcctgcaagcatggtggagacttgtatgtggtgggagggtccatcccacggcgcatgtggaagtgcaacaatgccaccgttgactgggagtggtgtgctcctttgcctcgggaccggctccagcacaccctggtgtctgtgcccgggaaagatgccatatattcactgggtggcaagacactgcaagataccctctccaacgcagtcatttattatcgcgtaggtgataatgtgtggacagagacaactcagctagaggtggctgtgtcaggggctgctggtgccaacctcaacgggatcatctacttactagggggggaggagaatgatctggacttctttaccaaaccttcccgactcatccagtgctttgacacagagacagacaaatgccatgtgaagccctatgtgctgccctttgcaggccgcatgcacgcagctgtgcataaagatctggtgttcatcgtggctgaaggggactccctggtgtgctacaatcccttgctagacagcttcacccggctttgccttcctgaggcctggagctctgccccatccctctggaagattgccagctgtaacgggagcatctatgtcttccgggaccgatataaaaagggggatgccaacacctacaagcttgaccctgccacttcagccgtaactgtcacaagaggtattaaggtgctgcttaccaatttgcagtttgtgttggcctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chaperonin containing TCP1, subunit 6B (zeta 2)
- family with sequence similarity 126, member B
- Usher syndrome 1C (autosomal recessive, severe)
- heterogeneous nuclear ribonucleoprotein L-like