FAM126B-family with sequence similarity 126, member B Gene View larger

FAM126B-family with sequence similarity 126, member B Gene

PTXBC039295

New product

Data sheet of FAM126B-family with sequence similarity 126, member B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about FAM126B-family with sequence similarity 126, member B Gene

Brand: ProteoGenix
Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC039295
Product type: DNA & cDNA
Ncbi symbol: FAM126B
Origin species: Human
Product name: FAM126B-family with sequence similarity 126, member B Gene
Size: 2ug
Accessions: BC039295
Gene id: 285172
Gene description: family with sequence similarity 126, member B
Synonyms: protein FAM126B; HYCC2; family with sequence similarity 126 member B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgctgggaactgaccgttgtgttgtggaagaatggttatcagaattcaaggcattacctgacactcagatcaccagttatgcagcaactttacaccgaaaaaaaacacttgtaccagccctctataaagttattcaagattcaaataatgagctcctggagcctgtctgccatcagctgtttgagctctatcgtagctcagaggttcgacttaagaggttcacactgcagttcttgccagaattgatgtgggtttatttacggcttacagttagccgagacagacagagtaatggttgcattgaagcacttctgttaggaatttacaatttggaaatcgctgataaagatgggaacaataaagttctgtctttcactatcccctccttatccaagccttcaatataccatgaaccttcaacaattggatccatggctttgacagaaggggcattgtgtcagcatgatctcatcagagttgtttatagtgatcttcatcctcagagggaaacattcactgcacagaaccggtttgaagtcctgagttttctcatgctgtgttataattctgctattgtatatatgcctgcctcatcttaccaatctctttgtcggatgggttccagggtttgtgtgagtggctttccacggcaacatgaaaaacactggaaagaactctgtggtcgaatagtattggatcctgaatttatggtgcaacttctcacaggggtttattatgccatgtataatggacagtgggaccttggccaggaagttcttgatgatatcatttatagagcccagctagagcttttttctcaaccactattggttgccaatgccatgaaaaactcattaccatttgatgctcctgattctacacaagaaggccagaaagtccttaaagttgaagtcactccaacagtgccgaggatttctcggactgcaattacaacagcttcaatccgtcgtcatagatggagaagagaaggtgctgagggtgtaaatggaggagaggagtctgtaaacctgaatgatgcagatgaaggattttcatcaggggcttccctcagcagtcagccaattgggaccaaaccatcctcctcttctcagaggggaagcttaaggaaagtagcaactgggcgttcagccaaggataaagaaacagcctctgccatcaaatccagtgagagccctcgagattcagtagttcgcaagcagtatgtacagcaaccaactgatcttagtgtagattcagttgagctgacaccaatgaagaaacacctgagcctgcctgctggccaggtggtgccaaaaatcaatagcttaagtctaatccggacagccagtgcttcctcaagtaaatcatttgactatgtaaatggcagtcaagcaagtaccagcattggggttggcactgagggaggtactaatttagcagccaacaatgctaatcgatactcaactgtcagtctgcaggaagaccggctaggtcaagctggcgaaggtaaagagctcctcagcccaggagcccccttgaccaagcagtctcgatccccaagtttcaatatgcagctaatatcccaggtgtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Usher syndrome 1C (autosomal recessive, severe)
- heterogeneous nuclear ribonucleoprotein L-like
- DCP1 decapping enzyme homolog A (S. cerevisiae)
- nuclear receptor subfamily 4, group A, member 2

Buy FAM126B-family with sequence similarity 126, member B Gene now

Add to cart