Login to display prices
Login to display prices
NR4A2-nuclear receptor subfamily 4, group A, member 2 Gene View larger

NR4A2-nuclear receptor subfamily 4, group A, member 2 Gene


New product

Data sheet of NR4A2-nuclear receptor subfamily 4, group A, member 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NR4A2-nuclear receptor subfamily 4, group A, member 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC009288
Product type: DNA & cDNA
Ncbi symbol: NR4A2
Origin species: Human
Product name: NR4A2-nuclear receptor subfamily 4, group A, member 2 Gene
Size: 2ug
Accessions: BC009288
Gene id: 4929
Gene description: nuclear receptor subfamily 4, group A, member 2
Synonyms: orphan nuclear receptor NR4A2; HZF-3; NOT; RNR1; TINUR; nuclear receptor subfamily 4 group A member 2; NGFI-B/nur77 beta-type transcription factor homolog; T-cell nuclear receptor NOT; immediate-early response protein NOT; intermediate-early receptor protein; nuclear receptor related 1; nur related protein-1, human homolog of; orphan nuclear receptor NURR1; transcriptionally inducible nuclear receptor related 1; transcriptionally-inducible nuclear receptor
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgccttgtgttcaggcgcagtatgggtcctcgcctcaaggagccagccccgcttctcagagctacagttaccactcttcgggagaatacagctccgatttcttaactccagagtttgtcaagtttagcatggacctcaccaacactgaaatcactgccaccacttctctccccagcttcagtacctttatggacaactacagcacaggctacgacgtcaagccaccttgcttgtaccaaatgcccctgtccggacagcagtcctccattaaggtagaagacattcagatgcacaactaccagcaacacagccacctgcccccccagtctgaggagatgatgccgcactccgggtcggtttactacaagccctcctcgcccccgacgcccaccaccccgggcttccaggtgcagcacagccccatgtgggacgacccgggatctctccacaacttccaccagaactacgtggccactacgcacatgatcgagcagaggaaaacgccagtctcccgcctctccctcttctcctttaagcaatcgccccctggcaccccggtgtctagttgccagatgcgcttcgacgggcccctgcacgtccccatgaacccggagcccgccggcagccaccacgtggtggacgggcagaccttcgctgtgcccaaccccattcgcaagcccgcgtccatgggcttcccgggcctgcagatcggccacgcgtctcagctgctcgacacgcaggtgccctcaccgccgtcgcggggctccccctccaacgaggggctgtgcgctgtgtgtggggacaacgcggcctgccaacactacggcgtgcgcacctgtgagggctgcaaaggcttctttaagcgcacagtgcaaaaaaatgcaaaatacgtgtgtttagcaaataaaaactgcccagtggacaagcgtcgccggaatcgctgtcagtactgccgatttcagaagtgcctggctgttgggatggtcaaagaagtggttcgcacagacagtttaaaaggccggagaggtcgtttgccctcgaaaccgaagagcccacaggagccctctcccccttcgcccccggtgagtctgatcagtgccctcgtcagggcccatgtcgactccaacccggctatgaccagcctggactattccaggttccaggcgaaccctgactatcaaatgagtggagatgacacccagcatatccagcaattctatgatctcctgactggctccatggagatcatccggggctgggcagagaagatccctggcttcgcagacctgcccaaagccgaccaagacctgctttttgaatcagctttcttagaactgtttgtccttcgattagcatacaggtccaacccagtggagggtaaactcatcttttgcaatggggtggtcttgcacaggttgcaatgcgttcgtggctttggggaatggattgattccattgttgaattctcctccaacttgcagaatatgaacatcgacatttctgccttctcctgcattgctgccctggctatggtcacagagagacacgggctcaaggaacccaagagagtggaagaactgcaaaacaagattgtaaattgtctcaaagaccacgtgactttcaacaatggggggttgaaccgccccaattatttgtccaaactgttggggaagctcccagaacttcgtaccctttgcacacaggggctacagcgcattttctacctgaaattggaagacttggtgccaccgccagcaataattgacaaacttttcctggacactttacctttctaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - v-raf-1 murine leukemia viral oncogene homolog 1
- kelch repeat and BTB (POZ) domain containing 7
- cutaneous T-cell lymphoma-associated antigen 1
- patatin-like phospholipase domain containing 8