RAF1-v-raf-1 murine leukemia viral oncogene homolog 1 Gene View larger

RAF1-v-raf-1 murine leukemia viral oncogene homolog 1 Gene


New product

Data sheet of RAF1-v-raf-1 murine leukemia viral oncogene homolog 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about RAF1-v-raf-1 murine leukemia viral oncogene homolog 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC018119
Product type: DNA & cDNA
Ncbi symbol: RAF1
Origin species: Human
Product name: RAF1-v-raf-1 murine leukemia viral oncogene homolog 1 Gene
Size: 2ug
Accessions: BC018119
Gene id: 5894
Gene description: v-raf-1 murine leukemia viral oncogene homolog 1
Synonyms: Oncogene RAF1; CMD1NN; CRAF; NS5; c-Raf; RAF proto-oncogene serine/threonine-protein kinase; C-Raf proto-oncogene, serine/threonine kinase; proto-oncogene c-RAF; raf proto-oncogene serine/threonine protein kinase; v-raf-1 murine leukemia viral oncogene homolog 1; v-raf-1 murine leukemia viral oncogene-like protein 1; Raf-1 proto-oncogene, serine/threonine kinase
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggagcacatacagggagcttggaagacgatcagcaatggttttggattcaaagatgccgtgtttgatggctccagctgcatctctcctacaatagttcagcagtttggctatcagcgccgggcatcagatgatggcaaactcacagatccttctaagacaagcaacactatccgtgttttcttgccgaacaagcaaagaacagtggtcaatgtgcgaaatggaatgagcttgcatgactgccttatgaaagcactcaaggtgaggggcctgcaaccagagtgctgtgcagtgttcagacttctccacgaacacaaaggtaaaaaagcacgcttagattggaatactgatgctgcgtctttgattggagaagaacttcaagtagatttcctggatcatgttcccctcacaacacacaactttgctcggaagacgttcctgaagcttgccttctgtgacatctgtcagaaattcctgctcaatggatttcgatgtcagacttgtggctacaaatttcatgagcactgtagcaccaaagtacctactatgtgtgtggactggagtaacatcagacaactcttattgtttccaaattccactattggtgatagtggagtcccagcactaccttctttgactatgcgtcgtatgcgagagtctgtttccaggatgcctgttagttctcagcacagatattctacacctcacgccttcacctttaacacctccagtccctcatctgaaggttccctctcccagaggcagaggtcgacatccacacctaatgtccacatggtcagcaccaccctgcctgtggacagcaggatgattgaggatgcaattcgaagtcacagcgaatcagcctcaccttcagccctgtccagtagccccaacaatctgagcccaacaggctggtcacagccgaaaacccccgtgccagcacaaagagagcgggcaccagtatctgggacccaggagaaaaacaaaattaggcctcgtggacagagagattcaagctattattgggaaatagaagccagtgaagtgatgctgtccactcggattgggtcaggctcttttggaactgtttataagggtaaatggcacggagatgttgcagtaaagatcctaaaggttgtcgacccaaccccagagcaattccaggccttcaggaatgaggtggctgttctgcgcaaaacacggcatgtgaacattctgcttttcatggggtacatgacaaaggacaacctggcaattgtgacccagtggtgcgagggcagcagcctctacaaacacctgcatgtccaggagaccaagtttcagatgttccagctaattgacattgcccggcagacggctcagggaatggactatttgcatgcaaagaacatcatccatagagacatgaaatccaacaatatatttctccatgaaggcttaacagtgaaaattggagattttggtttggcaacagtaaagtcacgctggagtggttctcagcaggttgaacaacctactggctctgtcctctggatggccccagaggtgatccgaatgcaggataacaacccattcagtttccagtcggatgtctactcctatggcatcgtattgtatgaactgatgacgggggagcttccttattctcacatcaacaaccgagatcagatcatcttcatggtgggccgaggatatgcctccccagatcttagtaagctatataagaactgccccaaagcaatgaagaggctggtagctgactgtgtgaagaaagtaaaggaagagaggcctctttttccccagatcctgtcttccattgagctgctccaacactctctaccgaagatcaaccggagcgcttccgagccatccttgcatcgggcagcccacactgaggatatcaatgcttgcacgctgaccacgtccccgaggctgcctgtcttctag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - kelch repeat and BTB (POZ) domain containing 7
- cutaneous T-cell lymphoma-associated antigen 1
- patatin-like phospholipase domain containing 8
- 1-acylglycerol-3-phosphate O-acyltransferase 3

Buy RAF1-v-raf-1 murine leukemia viral oncogene homolog 1 Gene now

Add to cart