Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of AGPAT3-1-acylglycerol-3-phosphate O-acyltransferase 3 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about AGPAT3-1-acylglycerol-3-phosphate O-acyltransferase 3 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC004219 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | AGPAT3 |
| Origin species: | Human |
| Product name: | AGPAT3-1-acylglycerol-3-phosphate O-acyltransferase 3 Gene |
| Size: | 2ug |
| Accessions: | BC004219 |
| Gene id: | 56894 |
| Gene description: | 1-acylglycerol-3-phosphate O-acyltransferase 3 |
| Synonyms: | LPAAT-GAMMA1; LPAAT3; 1-acyl-sn-glycerol-3-phosphate acyltransferase gamma; 1-AGP acyltransferase 3; 1-AGPAT 3; lysophosphatidic acid acyltransferase gamma; lysophosphatidic acid acyltransferase-gamma1; 1-acylglycerol-3-phosphate O-acyltransferase 3 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggggtctcctgcccatcttcccaaggatgccattgctgtcttcatcgtcttcccccgtgtgagacactggttgtctggtactcggcgacagtgtaccagacgcgcaccctatgtgaggtgctttaaggtccctgtcctcaggaagcgcagtctggtggaagagatgagcgctgaacaaatcactaaataa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - dehydrogenase/reductase (SDR family) member 11 - ribonuclease, RNase A family, 11 (non-active) - family with sequence similarity 128, member B - family with sequence similarity 174, member A |