Cart 0 Product Products (empty)
No products
To be determined Shipping
0,00 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 0 items in your cart. There is 1 item in your cart.
Total products (tax excl.)
Total shipping (tax excl.) To be determined
Total (tax excl.)
View larger 
Data sheet of RNASE11-ribonuclease, RNase A family, 11 (non-active) Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about RNASE11-ribonuclease, RNase A family, 11 (non-active) Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC025410 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | RNASE11 |
| Origin species: | Human |
| Product name: | RNASE11-ribonuclease, RNase A family, 11 (non-active) Gene |
| Size: | 2ug |
| Accessions: | BC025410 |
| Gene id: | 122651 |
| Gene description: | ribonuclease, RNase A family, 11 (non-active) |
| Synonyms: | C14orf6; HEL-S-84p; RAJ1; RNase 11; epididymis secretory sperm binding protein Li 84p; ribonuclease 11; ribonuclease A J1; ribonuclease, RNase A family, 11 (non-active); ribonuclease A family member 11 (inactive) |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggagacctttcctctgctgctgctcagcctgggcctggttcttgcagaagcatcagaaagcacaatgaagataattaaagaagaatttacagacgaagagatgcaatatgacatggcaaaaagtggccaagaaaaacagaccattgagatattaatgaacccgatcctgttagttaaaaataccagcctcagcatgtccaaggatgatatgtcttccacattactgacattcagaagtttacattataatgaccccaagggaaacagttcgggtaatgacaaagagtgttgcaatgacatgacagtctggagaaaagtttcagaagcaaacggatcgtgcaagtggagcaataacttcatccgcagctccacagaagtgatgcgcagggtccacagggcccccagctgcaagtttgtacagaatcctggcataagctgctgtgagagcctagaactggaaaatacagtgtgccagttcactacaggcaaacaattccccaggtgccaataccatagtgttacctcattagagaagatattgacagtgctgacaggtcattctctgatgagctggttagtttgtggctctaagttgtaa |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 128, member B - family with sequence similarity 174, member A - aldehyde dehydrogenase 2 family (mitochondrial) - family with sequence similarity 13, member C1 |