PTXBC017694
New product
This product is no longer in stock
Availability date:
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC017694 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | FAM128B |
| Origin species: | Human |
| Product name: | FAM128B-family with sequence similarity 128, member B Gene |
| Size: | 2ug |
| Accessions: | BC017694 |
| Gene id: | 80097 |
| Gene description: | family with sequence similarity 128, member B |
| Synonyms: | FAM128B; MOZART2B; mitotic-spindle organizing protein 2B; family with sequence similarity 128, member B; mitotic-spindle organizing protein associated with a ring of gamma-tubulin 2B; mitotic spindle organizing protein 2B |
| Sequence primers: | Forward primer M13R (5'â3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'â3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgttgcttctgctcccgatggctctctctgaaatgcagcacaacctcctaggccaatggaagaaggcccagagctggctccctgcctggaagcacgaggagacccgcacaggcatcctgagaaggcgtggagagcaggctgccttcatggggggagtgccagggcctgggcacccacacccgctgacccaagagggcccgggcacctgcgtgctggcctcttcactgaccttcgctctgtctgctctctttgtgtctctctctgacctccagaggcctcctttctctctgccaggaacagtagcccccctgcaaggccctccttttcctccagcccgcagcctgcggcctctccggttctgctccacagcccggctgccacacactcgcctctctctccaggccccccgggttccctccgcctctcttgctgcctgttctctccttttgcaggttgcgtttattggcttatctctgggggttggtgctctcccttgtttccatggaaactgcctggccccaggaggcccaagcagctttgagctccaagggcaggaccatgcaggccatcgctgccctgccgcttag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20â |
| Delivery condition: | Blue Ice |
| Related products: | - family with sequence similarity 174, member A - aldehyde dehydrogenase 2 family (mitochondrial) - family with sequence similarity 13, member C1 - v-raf murine sarcoma 3611 viral oncogene homolog |