USH1C-Usher syndrome 1C (autosomal recessive, severe) Gene View larger

USH1C-Usher syndrome 1C (autosomal recessive, severe) Gene


New product

Data sheet of USH1C-Usher syndrome 1C (autosomal recessive, severe) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about USH1C-Usher syndrome 1C (autosomal recessive, severe) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC016057
Product type: DNA & cDNA
Ncbi symbol: USH1C
Origin species: Human
Product name: USH1C-Usher syndrome 1C (autosomal recessive, severe) Gene
Size: 2ug
Accessions: BC016057
Gene id: 10083
Gene description: Usher syndrome 1C (autosomal recessive, severe)
Synonyms: AIE-75; DFNB18; DFNB18A; NY-CO-37; NY-CO-38; PDZ-45; PDZ-73; PDZ-73/NY-CO-38; PDZ73; PDZD7C; ush1cpst; harmonin; Usher syndrome 1C (autosomal recessive, severe); antigen NY-CO-38/NY-CO-37; autoimmune enteropathy-related antigen AIE-75; renal carcinoma antigen NY-REN-3; usher syndrome type-1C protein; USH1 protein network component harmonin
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggaccgaaaagtggcccgagaattccggcataaggtggattttctgattgaaaatgatgcagagaaggactatctctatgatgtgctgcgaatgtaccaccagaccatggacgtggccgtgctcgtgggagacctgaagctggtcatcaatgaacccagccgtctgcctctgtttgatgccattcggccgctgatcccactgaagcaccaggtggaatatgatcagctgaccccccggcgctccaggaagctgaaggaggtgcgtctggaccgtctgcaccccgaaggcctcggcctgagtgtgcgtggtggcctggagtttggctgtgggctcttcatctcccacctcatcaaaggcggtcaggcagacagcgtcgggctccaggtaggggacgagatcgtccggatcaatggatattccatctcctcctgtacccatgaggaggtcatcaacctcattcgaaccaagaaaactgtgtccatcaaagtgagacacatcggcctgatccccgtgaaaagctctcctgatgagcccctcacttggcagtatgtggatcagtttgtgtcggaatctgggggcgtgcgaggcagcctgggctcccctggaaatcgggaaaacaaggagaagaaggtcttcatcagcctggtaggctcccgaggccttggctgcagcatttccagcggccccatccagaagcctggcatctttatcagccatgtgaaacctggctccctgtctgctgaggtgggattggagataggggaccagattgtcgaagtcaatggcgtcgacttctctaacctggatcacaaggagggccgggagctgttcatgacagaccgggagcggctggcagaggcgcggcagcgtgagctgcagcggcaggagcttctcatgcagaagcggctggcgatggagtccaacaagatcctccaggagcagcaggagatggagcggcaaaggagaaaagaaattgcccagaaggcagcagaggaaaatgagagataccggaaggagatggaacagattgtagaggaggaagagaagtttaagaagcaatgggaagaagactggggctcaaaggaacagctactcttgcctaaaaccatcactgctgaggtacacccggtaccccttcgcaagccaaagtatgatcagggagtggaacctgagctcgagcccgcagatgacctggatggaggcacggaggagcagggagagcaggatttccggaaatatgaggaaggctttgacccctactctatgttcaccccagagcagatcatggggaaggatgtccggctcctacgcatcaagaaggagggatccttagacctggccctggaaggcggtgtggactcccccattgggaaggtggttgtttctgctgtgtatgagcggggagctgctgagcggcatggtggcattgtgaaaggggacgagatcatggcaatcaacggcaagattgtgacagactacaccctggctgaggctgacgctgccctgcagaaggcctggaatcagggcggggactggatcgaccttgtggttgccgtctgccccccaaaggagtatgacgatgagctgaccttcttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - heterogeneous nuclear ribonucleoprotein L-like
- DCP1 decapping enzyme homolog A (S. cerevisiae)
- nuclear receptor subfamily 4, group A, member 2
- v-raf-1 murine leukemia viral oncogene homolog 1

Buy USH1C-Usher syndrome 1C (autosomal recessive, severe) Gene now

Add to cart