Login to display prices
Login to display prices
CCT6B-chaperonin containing TCP1, subunit 6B (zeta 2) Gene View larger

CCT6B-chaperonin containing TCP1, subunit 6B (zeta 2) Gene

PTXBC026125

New product

Data sheet of CCT6B-chaperonin containing TCP1, subunit 6B (zeta 2) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about CCT6B-chaperonin containing TCP1, subunit 6B (zeta 2) Gene

Availability: PRODUCT NOT AVAILABLE
Proteogenix catalog: PTXBC026125
Ncbi symbol: CCT6B
Product name: CCT6B-chaperonin containing TCP1, subunit 6B (zeta 2) Gene
Size: 2ug
Accessions: BC026125
Gene id: 10693
Gene description: chaperonin containing TCP1, subunit 6B (zeta 2)
Synonyms: CCT-zeta-2; CCTZ-2; Cctz2; TCP-1-zeta-2; TSA303; T-complex protein 1 subunit zeta-2; chaperonin containing TCP1, subunit 6B (zeta 2); chaperonin-containing T-complex polypeptide 1, subunit 6B; testis-specific Tcp20; testis-specific protein TSA303; chaperonin containing TCP1 subunit 6B
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcgataaaggccgtcaactccaaggctgaggtggcgcgggcccaggcagctttggctgtcaatatatgcgccgcccgagggctgcaggatgtgctgcggaccaacttgggtcctaaaggcaccatgaaaatgcttgcttctggtgcaggtgacatcaaactcaccaaagatggcaatgtactgctcgatgagatgcaaattcaacatccaacagcttccttgatagcaaaagtagcaacagctcaggatgacgtcacaggagatggtactacttcaaatgttctaattattggagagttattaaaacaagctgacctgtacatttctgagggcctgcaccctagaataatagctgaaggatttgaagctgcaaagataaaagcacttgaagttttggaggaagttaaagtgacaaaggagatgaaaagaaaaatcctcttagatgtagctagaacatcattacaaactaaagttcatgctgaactggctgatgtcttaacagaggttgtggtggattctgttttggctgttagaagaccaggttaccctattgatctcttcatggtagaaataatggagatgaagcataaattaggaacagatacaaagttgatccaaggattagttttggatcatggtgcccgtcatccagatatgaagaagcgagtagaagatgcatttatccttatttgcaacgtttcactggaatatgaaaaaacagaggtgaactctggtttcttttataagactgcagaagagaaagagaaattggtaaaagctgaaagaaaatttattgaagatagagtacaaaaaataatagacctgaaggacaaagtctgtgctcagtcaaataaaggatttgtcgtcattaatcaaaagggaattgatccattttccttagattctcttgcaaaacatggaatagtagctcttcgcagagcaaaaagaagaaatatggaaagactctctcttgcttgtggtggaatggccgtgaattcttttgaagatctcactgtagattgcttgggacatgctggtcttgtgtatgagtatacattaggtgaagaaaagttcacttttattgaggagtgtgttaacccttgctctgttaccttgttggttaaaggaccaaataagcatactctcacacaagtcaaggatgccataagagatggacttcgtgctatcaaaaatgccattgaagatggttgtatggttcctggagctggtgcaattgaagtggcaatggctgaagctcttgttacatataagaacagtataaaaggaagagctcgtcttggagtccaagcttttgctgatgccttactcattattcccaaggttcttgctcagaatgctggttatgacccacaggaaacattagtaaaagttcaggctgagcatgtcgagtcaaaacaacttgtgggcgtagatttgaatacaggtgagccaatggtagcagcagatgcaggagtttgggataattattgtgtaaaaaaacaacttcttcactcttgcacagtgattgccaccaacattctcctggttgatgaaattatgcgagctgggatgtcttctctcaaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: