PPARG-peroxisome proliferator-activated receptor gamma Gene View larger

PPARG-peroxisome proliferator-activated receptor gamma Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of PPARG-peroxisome proliferator-activated receptor gamma Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about PPARG-peroxisome proliferator-activated receptor gamma Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC006811
Product type: DNA & cDNA
Ncbi symbol: PPARG
Origin species: Human
Product name: PPARG-peroxisome proliferator-activated receptor gamma Gene
Size: 2ug
Accessions: BC006811
Gene id: 5468
Gene description: peroxisome proliferator-activated receptor gamma
Synonyms: CIMT1; GLM1; NR1C3; PPARG1; PPARG2; peroxisome proliferator-activated receptor gamma; PPAR-gamma; nuclear receptor subfamily 1 group C member 3; peroxisome proliferator-activated nuclear receptor gamma variant 1; peroxisome proliferator activated receptor gamma
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaccatggttgacacagagatgccattctggcccaccaactttgggatcagctccgtggatctctccgtaatggaagaccactcccactcctttgatatcaagcccttcactactgttgacttctccagcatttctactccacattacgaagacattccattcacaagaacagatccagtggttgcagattacaagtatgacctgaaacttcaagagtaccaaagtgcaatcaaagtggagcctgcatctccaccttattattctgagaagactcagctctacaataagcctcatgaagagccttccaactccctcatggcaattgaatgtcgtgtctgtggagataaagcttctggatttcactatggagttcatgcttgtgaaggatgcaagggtttcttccggagaacaatcagattgaagcttatctatgacagatgtgatcttaactgtcggatccacaaaaaaagtagaaataaatgtcagtactgtcggtttcagaaatgccttgcagtggggatgtctcataatgccatcaggtttgggcggatgccacaggccgagaaggagaagctgttggcggagatctccagtgatatcgaccagctgaatccagagtccgctgacctccgggccctggcaaaacatttgtatgactcatacataaagtccttcccgctgaccaaagcaaaggcgagggcgatcttgacaggaaagacaacagacaaatcaccattcgttatctatgacatgaattccttaatgatgggagaagataaaatcaagttcaaacacatcacccccctgcaggagcagagcaaagaggtggccatccgcatctttcagggctgccagtttcgctccgtggaggctgtgcaggagatcacagagtatgccaaaagcattcctggttttgtaaatcttgacttgaacgaccaagtaactctcctcaaatatggagtccacgagatcatttacacaatgctggcctccttgatgaataaagatggggttctcatatccgagggccaaggcttcatgacaagggagtttctaaagagcctgcgaaagccttttggtgactttatggagcccaagtttgagtttgctgtgaagttcaatgcactggaattagatgacagcgacttggcaatatttattgctgtcattattctcagtggagaccgcccaggtttgctgaatgtgaagcccattgaagacattcaagacaacctgctacaagccctggagctccagctgaagctgaaccaccctgagtcctcacagctgtttgccaagctgctccagaaaatgacagacctcagacagattgtcacggaacacgtgcagctactgcaggtgatcaagaagacggagacagacatgagtcttcacccgctcctgcaggagatctacaaggacttgtactag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - ankyrin repeat and BTB (POZ) domain containing 1
- bruno-like 5, RNA binding protein (Drosophila)
- NGFI-A binding protein 1 (EGR1 binding protein 1)
- viral DNA polymerase-transactivated protein 6

Buy PPARG-peroxisome proliferator-activated receptor gamma Gene now

Add to cart