BRUNOL5-bruno-like 5, RNA binding protein (Drosophila) Gene View larger

BRUNOL5-bruno-like 5, RNA binding protein (Drosophila) Gene

PTXBC028101

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of BRUNOL5-bruno-like 5, RNA binding protein (Drosophila) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about BRUNOL5-bruno-like 5, RNA binding protein (Drosophila) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028101
Product type: DNA & cDNA
Ncbi symbol: BRUNOL5
Origin species: Human
Product name: BRUNOL5-bruno-like 5, RNA binding protein (Drosophila) Gene
Size: 2ug
Accessions: BC028101
Gene id: 60680
Gene description: bruno-like 5, RNA binding protein (Drosophila)
Synonyms: BRUNOL5; BRUNOL-5; CELF-5; CUGBP Elav-like family member 5; CUG-BP and ETR-3 like factor 5; RNA-binding protein BRUNOL-5; bruno-like 5 RNA binding protein; CUGBP, Elav-like family member 5
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcccgcctgacggagagcgaggcgcgccggcagcagcagcagctcctgcagccgcggccctcgcccgtgggcagcagcgggcccgagccccccggggggcagcccgacggcatgaaggacctggacgccatcaaactcttcgtgggccagatcccccggcacctggacgagaaggacctcaagccgctcttcgagcagttcggccgcatctacgagctcacggtgctcaaagacccctacacggggatgcacaaaggctgtgccttcctcacctactgtgccagggattccgccatcaaagctcagactgccctgcacgagcagaagaccttgcccggaatggcgcggccaatccaggtgaagcctgcggacagtgaaagccgcggaggtagggaccggaagctgttcgtggggatgctgaacaagcagcagtcggaggaggacgtgctgcggctgttccagcccttcggggtcattgacgagtgcaccgtgctccgggggcctgacggcagcagcaaaggctgtgctttcgtgaagttctcctcccacacggaggcgcaggcggccatccacgccttgcatgggagccagaccatgccgggagcctcctccagcctggtggtcaagttcgccgacacggacaaggagcggacgctccggcgcatgcagcagatggtgggccagctgggcatcctgacgccgtccctcacattgcccttcagcccctacagtgcctacgcccaggctctcatgcaacagcagacaacagtcctgtccacctcgggcagctacctgagtcccggcgtggccttctcaccctgtcacatccagcagataggcgccgtcagcctcaacgggctgcctgccacacccatcgctcctgcctctgggctgcactcacccccgctgctgggcaccaccgctgtgcctggcctcgtggctcccatcaccaatggctttgcaggtgtcgtgccctttccaggtgggcaccctgccctggaaaccgtctatgccaatggccttgtgccctacccagctcagagcccgactgtggccgagacactgcatcctgccttctccggagtccagcagtacacagccatgtaccccaccgcggccatcacgcccatcgcgcacagcgtcccccagccgccgcccctcctgcagcagcagcagcgagaaggtcccgagggctgtaacctgtttatctaccacctcccccaggagtttggagacacggagctgacgcagatgttcctacccttcggcaatatcatttcctccaaggtgtttatggatcgagctaccaaccagagcaagtgtttcggcttcgtgagctttgataacccggccagcgcccaggcagccatccaggccatgaacggcttccagatcggcatgaagaggctcaaagtccagctgaagcggcccaaagacccgggacacccctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - NGFI-A binding protein 1 (EGR1 binding protein 1)
- viral DNA polymerase-transactivated protein 6
- RAB guanine nucleotide exchange factor (GEF) 1
- phosphoinositide-3-kinase, regulatory subunit 5

Buy BRUNOL5-bruno-like 5, RNA binding protein (Drosophila) Gene now

Add to cart