Login to display prices
Login to display prices
NAB1-NGFI-A binding protein 1 (EGR1 binding protein 1) Gene View larger

NAB1-NGFI-A binding protein 1 (EGR1 binding protein 1) Gene

PTXBC035724

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NAB1-NGFI-A binding protein 1 (EGR1 binding protein 1) Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about NAB1-NGFI-A binding protein 1 (EGR1 binding protein 1) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035724
Product type: DNA & cDNA
Ncbi symbol: NAB1
Origin species: Human
Product name: NAB1-NGFI-A binding protein 1 (EGR1 binding protein 1) Gene
Size: 2ug
Accessions: BC035724
Gene id: 4664
Gene description: NGFI-A binding protein 1 (EGR1 binding protein 1)
Synonyms: NGFI-A-binding protein 1; EGR-1-binding protein 1; EGR1 binding protein 1; transcriptional regulatory protein p54; NGFI-A binding protein 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcggccttacccaggaccctgggggagttgcagctgtatagaatattacaaaaagccaatctactttcttattttgatgcctttatccaacaaggtggtgatgatgtccagcaactctgtgaagcaggagaagaggagtttttggaaatcatggcactcgtgggcatggctagcaagccccttcatgttagaaggctgcagaaggctttgagagactgggtcacaaaccctgggcttttcaatcagccactgacttcccttcctgtcagtagcatacccatctataaattaccagagggatcaccaacatggctgggaatatcctgcagtagttatgaaaggagtagcaatgcccgggaacctcatttaaaaatccccaaatgtgctgccaccacctgtgtgcagagcttgggacaggggaagtcagatgtggttgggagcctagcactgcagagtgttggtgagtccagactctggcaaggccaccatgccactgagagcgagcacagcctctccccagcagacctgggctcccccgcgtccccaaaggagagcagtgaggcgctggatgctgctgctgcgctctctgtggctgagtgtgtggagcggatggcccccacactgccaaaaagtgacttgaatgaagtgaaagagctgctaaaaaccaacaagaagttggccaaaatgattggtcacatctttgagatgaacgatgatgatccacacaaagaggaggaaattcggaaatacagtgcaatatatggcagatttgactcaaagaggaaggatgggaaacatctcacacttcatgagctcactgttaatgaagcggctgctcaactctgtgtgaaggataatgccctgctgacaagaagagatgagctttttgccttggctcgacagatttctcgagaagtcacctataaatatacttacagaaccaccaagtcaaaatgtggagaaagagatgaattatccccaaagagaattaaagtggaggatgggtttccagatttccaggattctgtgcaaacactcttccagcaggctagagctaagagtgaagaacttgcagctcttagttcacagcagcctgaaaaggtgatggcaaagcagatggagttcctttgcaaccaagctggctatgagagactgcagcatgccgagaggaggttgtctgcagggctttacaggcagagctcagaagagcacagtcctaacggcttgacttccgataactcagatggacaaggagaaagacctttgaatctccgaatgcctaatttacagaacagacaaccccatcattttgtggtggatggggagctgagcagactttaccccagtgaggcaaagtcccactcatcagagagccttgggattttaaaagactaccctcattcagcttttaccttagaaaagaaagtcatcaaaacagagcctgaagattcaagatag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - viral DNA polymerase-transactivated protein 6
- RAB guanine nucleotide exchange factor (GEF) 1
- phosphoinositide-3-kinase, regulatory subunit 5
- Wiskott-Aldrich syndrome (eczema-thrombocytopenia)