ABTB1-ankyrin repeat and BTB (POZ) domain containing 1 Gene View larger

ABTB1-ankyrin repeat and BTB (POZ) domain containing 1 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ABTB1-ankyrin repeat and BTB (POZ) domain containing 1 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ABTB1-ankyrin repeat and BTB (POZ) domain containing 1 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC011858
Product type: DNA & cDNA
Ncbi symbol: ABTB1
Origin species: Human
Product name: ABTB1-ankyrin repeat and BTB (POZ) domain containing 1 Gene
Size: 2ug
Accessions: BC011858
Gene id: 80325
Gene description: ankyrin repeat and BTB (POZ) domain containing 1
Synonyms: BPOZ; BTB3; BTBD21; EF1ABP; PP2259; ankyrin repeat and BTB/POZ domain-containing protein 1; ankyrin repeat and BTB (POZ) domain containing 1; elongation factor 1A-binding protein; ankyrin repeat and BTB domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggacaccagcgacctgttcgccagctgcaggaagggggatgtgggccgagtgcggtacctgctggagcagcgagacgtggaggtgaatgtgcgggacaagtgggacagcacccccttgtactatgcctgcttgtgtgggcacgaggagctggtactctaccttctggccaatggagcccgctgcgaggccaacaccttcgatggtgagcgctgcctctatggggcactgagtgaccccatccgccgggctctacgcgattacaagcaggtcacggcttcctgcaggaggcgggattactatgacgacttcttgcagcggcttctagagcagggcatccacagtgacgtggtctttgtagtacacgggaagccattccgggtgcatcgctgcgtcctgggtgcacgtagtgcctactttgccaacatgctggacaccaaatggaagggcaagagtgtcgtggttctcaggcacccactgatcaaccccgtggcctttggggccctgctgcagtacctgtacacaggccgcctggacattggcgtagagcatgtgagtgactgtgagcgcctggccaagcaatgccagctgtgggacctgctcagcgacctggaggccaagtgcgagaaggtgtctgagtttgtggcgtctaagccaggcacgtgtgtgaaggtgctgaccatcgagcccccacctgcagacccccgcctccgggaggacatggcgctgctggccgattgtgccctgccccccgagctccgaggtgatctttgggagctgcccttcccttgtcctgacggcttcaacagctgccctgacatctgcttccgagtggctggctgcagcttcctctgccacaaggcctttttctgtggccgcagtgactacttccgagccctgctggatgaccacttccgagagagcgaggagccagcgacctcagggggccccccagccgtcaccctgcatggcatctcacccgacgtcttcactcacgtgctctactacatgtacagcgaccacactgagctgtcccccgaggcagcctatgatgtgctgagcgtcgccgacatgtacctgctgccaggcctgaagaggctgtgcggccgcagcctggctcagatgctagacgaggacactgtggtgggtgtgtggcgcgtggccaagctcttccgcctggcgcggcttgaggaccagtgcactgagtacatggccaaggtcattgagaagctggtggagcgggaggacttcgtggaggcggtgaaggaggaggcagcggctgtggcagcccggcaggagacggactctatcccgctggtggacgacatccgcttccacgtggccagcacggtgcagacctacagcgccatagaggaggcgcagcagcgtctgcgggcactcgaggacctgctcgtgtccatcggtctggactgttga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - bruno-like 5, RNA binding protein (Drosophila)
- NGFI-A binding protein 1 (EGR1 binding protein 1)
- viral DNA polymerase-transactivated protein 6
- RAB guanine nucleotide exchange factor (GEF) 1

Buy ABTB1-ankyrin repeat and BTB (POZ) domain containing 1 Gene now

Add to cart