Cart 30 Product Products 4 615,70 € (empty)
-
1 x TNFSF14-tu...113,40 € -
1 x PDZK1IP1-P...113,40 € -
1 x CXCL10-che...113,40 € -
1 x KIAA1305-K...113,40 € -
1 x MCFD2-mult...113,40 € -
1 x WFDC5-WAP...113,40 € -
1 x NDFIP1-Ned...113,40 € -
1 x DNASE1-deo...121,50 € -
-
-
-
1 x TAF1D-TATA...121,50 € -
1 x JTV1-JTV1...121,50 € -
1 x MGC14425-h...113,40 € -
1 x MCTS1-mali...113,40 € -
1 x IMP3-IMP3,...113,40 € -
1 x SOCS4-supp...121,50 € -
1 x IL20RB-int...121,50 € -
-
1 x PEF1-penta...121,50 € -
1 x PPIA-pepti...113,40 € -
1 x PECI-perox...121,50 € -
1 x MAPK8IP2-m...121,50 € -
-
1 x TCTN3-tect...121,50 € -
1 x PMVK-phosp...113,40 € -
1 x METTL8-met...113,40 € -
-
-
No products
To be determined Shipping
4 615,70 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 30 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 4 615,70 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 4 615,70 €
View larger 
Data sheet of GABRD-gamma-aminobutyric acid (GABA) A receptor, delta Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about GABRD-gamma-aminobutyric acid (GABA) A receptor, delta Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC033801 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | GABRD |
| Origin species: | Human |
| Product name: | GABRD-gamma-aminobutyric acid (GABA) A receptor, delta Gene |
| Size: | 2ug |
| Accessions: | BC033801 |
| Gene id: | 2563 |
| Gene description: | gamma-aminobutyric acid (GABA) A receptor, delta |
| Synonyms: | EIG10; EJM7; GEFSP5; gamma-aminobutyric acid receptor subunit delta; GABA(A) receptor subunit delta; GABA(A) receptor, delta; GABA-A receptor, delta polypeptide; gamma-aminobutyric acid (GABA) A receptor, delta; gamma-aminobutyric acid type A receptor delta subunit |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atggacgcgcccgcccggctgctggccccgctcctgctcctctgcgcgcagcagctccgcggcaccagagcgatgaatgacatcggcgactacgtgggctccaacctggagatctcctggctccccaacctggacgggctgatagccggctacgcccgcaacttccggcctggcatcggaggcccccccgtgaatgtggcccttgccctggaggtggccagcatcgaccacatctcagaggccaacatggagtacaccatgacggtgttcctgcaccagagctggcgggacagcaggctctcctacaaccacaccaacgagaccctgggcctggacagccgcttcgtggacaagctgtggctgcccgacaccttcatcgtgaacgccaagtcggcctggttccacgacgtgacggtggagaacaagctcatccggctgcagcccgacggcgtgatcctgtacagcatccgaatcacctccactgtggcctgcgacatggacctggccaaataccccatggacgagcaggagtgcatgctggacctggagagctacggttactcatcggaggacatcgtctactactggtcggagagccaggagcacatccacgggctggacaagctgcagctggcgcagttcaccatcaccagctaccgcttcaccacggagctgatgaacttcaagtccgctggccagttcccacggctcagcctgcacttccacctgcggaggaaccgcggcgtgtacatcatccaatcctacatgccctccgtcctgctggtcgccatgtcctgggtctccttctggatcagccaggcggcggtgcccgccagggtgtctctaggcatcaccacggtgctgacgatgaccacgctcatggtcagtgcccgctcctccctgccacgggcatcagccatcaaggcactggacgtctacttctggatctgctatgtcttcgtgtttgccgccctggtggagtacgcctttgctcatttcaacgccgactacaggaagaagcagaaggccaaggtcaaggtctccaggccgagggcagagatggacgtgaggaacgccattgtcctcttctccctctctgctgccggcgtcacgcaggagctggccatctcccgccggcagcgccgcgtcccggggaacctgatgggctcctacaggtcggtgggggtggagacaggggagacgaagaaggagggggcagcccgctcaggaggccaggggggcatccgtgcccggctcaggcccatcgacgcagacaccattgacatttacgcccgcgctgtgttccctgcggcgtttgcggccgtcaatgtcatctactgggcggcatacgccatgtga |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - succinate-CoA ligase, ADP-forming, beta subunit - peroxisome proliferator-activated receptor gamma - ankyrin repeat and BTB (POZ) domain containing 1 - bruno-like 5, RNA binding protein (Drosophila) |