Login to display prices
Login to display prices
RAPGEF5-Rap guanine nucleotide exchange factor (GEF) 5 Gene View larger

RAPGEF5-Rap guanine nucleotide exchange factor (GEF) 5 Gene

PTXBC039203

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of RAPGEF5-Rap guanine nucleotide exchange factor (GEF) 5 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about RAPGEF5-Rap guanine nucleotide exchange factor (GEF) 5 Gene

Proteogenix catalog: PTXBC039203
Ncbi symbol: RAPGEF5
Product name: RAPGEF5-Rap guanine nucleotide exchange factor (GEF) 5 Gene
Size: 2ug
Accessions: BC039203
Gene id: 9771
Gene description: Rap guanine nucleotide exchange factor (GEF) 5
Synonyms: GFR; MR-GEF; REPAC; rap guanine nucleotide exchange factor 5; M-Ras-regulated GEF; M-Ras-regulated Rap GEF; Rap guanine nucleotide exchange factor (GEF) 5; guanine nucleotide exchange factor for Rap1; related to Epac
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgggcagctcccggctgagggtctttgaccctcatttggagaggaaagattccgccgcggcgctctcagaccgagagctgcccttgcctaccttcgatgtgccttatttcaaatacatcgacgaggaggatgaggacgatgaatggagcagccgctcgcagtcttccaccgaggatgactcagtggactctctgctctctgacagatatgtggtggtgtccgggaccccggagaagattttggagcaccttttgaatgacttgcacctggaagaagtccaggacaaagaaacagagaccctcctggatgacttccttctcacgtacactgtcttcatgacaactgatgacttgtgccaggctctgttaaggcactattctgctaagaagtatcaaggcaaagaggaaaactcagatgttccgcgtaggaaacgtaaagtcttgcatcttgtttcccagtggattgctctgtacaaagactggttacctgaagatgaacattcaaaaatgtttttaaagaccatatataggaatgtactggatgatgtttatgaatatccaatacttgaaaaagaattgaaagaatttcaaaagatacttggaatgcaccgtcgtcacactgtagatgaatattcaccacaaaaaaagaataaagcccttttccaccaattcagtcttaaggagaactggctccagcatagaggaactgtgactgaaacggaggaaattttctgccacgtgtatataacagagcactcctatgtcagtgtgaaggcaaaagtttccagtatagcccaagagattctgctctgcagccagctgggcaagcgagtgcagctggtgaaaaaattcatcaaaattgcggctcactgcaaagcccagagaaacctgaattctttctttgccattgtgatgggtctcaacactgcttctgtcagtcgactgtcgcagacctgggagaaaatccctgggaagtttaagaaacttttctctgaacttgaaagtttaacagatccttccctaaatcacaaagcctacagagatgcattcaaaaagatgaagccaccaaaaatccctttcgtgcccttattgcttaaagatgtaacatttattcatgaaggaaataaaacttttttggataatcttgtcaattttgaaaagctgcatatgatcgcagacactgtccgaaccctgagacactgcaggactaaccagtttggtgacctgtctccaaaagagcatcaagagttaaagtcctatgttaatcacctgtatgtcattgacagccagcaggctctgtttgagctctcacacaggatcgagcctcgggtgtga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: