WIPI2-WD repeat domain, phosphoinositide interacting 2 Gene View larger

WIPI2-WD repeat domain, phosphoinositide interacting 2 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of WIPI2-WD repeat domain, phosphoinositide interacting 2 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about WIPI2-WD repeat domain, phosphoinositide interacting 2 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC007596
Product type: DNA & cDNA
Ncbi symbol: WIPI2
Origin species: Human
Product name: WIPI2-WD repeat domain, phosphoinositide interacting 2 Gene
Size: 2ug
Accessions: BC007596
Gene id: 26100
Gene description: WD repeat domain, phosphoinositide interacting 2
Synonyms: ATG18B; Atg21; CGI-50; WIPI-2; WD repeat domain phosphoinositide-interacting protein 2; WD40 repeat protein interacting with phosphoinositides 2; WIPI49-like protein 2; WD repeat domain, phosphoinositide interacting 2
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgaacctggcgagccagagcggggaggccggcgccggccagctgctcttcgccaacttcaaccaggacaacacgtccctagctgttggtagtaagtccggttataaatttttctccctttcttctgtggataagctggaacagatctatgaatgcaccgatacggaagatgtgtgcattgtagagagattgttctccagcagcctagtggccatcgtgagccttaaagcaccaaggaagctaaaggtttgccactttaagaagggaactgagatctgcaactacagctactccaacacgattctggctgtgaagctcaacaggcagaggctgatagtatgcctggaggagtccctgtacatccacaacattcgggacatgaaggtgctgcatacgatcagggagacgcctccaaaccctgcaggcctgtgtgcgctgtcaatcaacaacgacaactgctacttggcgtacccagggagcgcgaccatcggagaggtgcaggtcttcgataccattaatttgagagctgcaaacatgattccggctcacgacagtcctttagcggcactggcctttgacgcaagtggaactaaacttgccacggcttcggagaaggggaccgtgattagggtattttccattccagaaggacaaaaactctttgagtttcggagaggagtaaagaggtgcgtgagcatctgctccctggccttcagcatggacggcatgttcctctccgcctccagcaacactgagaccgtgcacatcttcaaactcgagactgtgaaagaaaaacccccagaggagcccaccacctggaccgggtacttcgggaaagtgctcatggcctccaccagctacctgccttcccaagtgacagaaatgttcaaccagggcagagccttcgccacggtccgcctgccattctgcggccacaaaaacatctgctcgctagccacaattcagaagatcccgcggttgttggtgggtgccgccgacgggtacctgtacatgtacaacctggacccccaggagggcggcgagtgtgccctgatgaagcagcaccggctggacggcagtctggaaacgaccaatgagatcttggactctgcctctcacgactgccccttagtcactcagacatacggcgcagctgcaggaaaaggtacttacgtgccttcatccccaacgagacttgcctacacagacgacctgggtgctgtgggtggcgcctgcctggaggacgaggccagcgccctgcgcctggatgaggacagcgagcacccgcccatgattcttcggactgactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - Rap guanine nucleotide exchange factor (GEF) 5
- gamma-aminobutyric acid (GABA) A receptor, delta
- succinate-CoA ligase, ADP-forming, beta subunit
- peroxisome proliferator-activated receptor gamma

Buy WIPI2-WD repeat domain, phosphoinositide interacting 2 Gene now

Add to cart