Cart 2 Product Products 234,90 € (empty)
-
1 x WDR61-WD...121,50 € -
1 x HBZ-hemogl...113,40 €
No products
To be determined Shipping
234,90 € Total
Prices are tax excluded
Product successfully added to your shopping cart
Quantity
Total
There are 2 items in your cart. There is 1 item in your cart.
Total products (tax excl.) 234,90 €
Total shipping (tax excl.) To be determined
Total (tax excl.) 234,90 €
View larger 
Data sheet of IGSF11-immunoglobulin superfamily, member 11 Gene
| Brand | ProteoGenix |
| Product type | DNA & cDNA |
| Origin species | Human |
More info about IGSF11-immunoglobulin superfamily, member 11 Gene
| Brand: | ProteoGenix |
| Proteogenix catalog: | PTXBC034411 |
| Product type: | DNA & cDNA |
| Ncbi symbol: | IGSF11 |
| Origin species: | Human |
| Product name: | IGSF11-immunoglobulin superfamily, member 11 Gene |
| Size: | 2ug |
| Accessions: | BC034411 |
| Gene id: | 152404 |
| Gene description: | immunoglobulin superfamily, member 11 |
| Synonyms: | BT-IgSF; CT119; CXADRL1; Igsf13; VSIG3; immunoglobulin superfamily member 11; CXADR like 1; V-set and immunoglobulin domain containing 3; V-set and immunoglobulin domain-containing protein 3; brain and testis-specific immunoglobin superfamily protein; brain and testis-specific immunoglobulin superfamily protein; cancer/testis antigen 119 |
| Sequence primers: | Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG |
| Orf sequence: | atgtctctggtggaacttttgctctggtggaactgcttttctagaactggtgttgcagcatccctggaagtgtcagagagccctgggagtatccaggtggcccggggtcagacagcagtcctgccctgcactttcactaccagcgctgccctcattaacctcaatgtcatttggatggtcactcctctctccaatgccaaccaacctgaacaggtcatcctgtatcagggtggacagatgtttgatggtgccccccggttccacggtagggtaggatttacaggcaccatgccagctaccaatgtctctatcttcattaataacactcagttatcagacactggcacctaccagtgcctggtcaacaaccttccagacatagggggcaggaacattggggtcaccggtctcacagtgttagttcccccttctgccccacactgccaaatccaaggatcccaggatattggcagcgatgtcatcctgctctgtagctcagaggaaggcattcctcgaccaacttacctttgggagaagttagacaataccctcaaactacctccaacagctactcaggaccaggtccagggaacagtcaccatccggaacatcagtgccctgtcttcaggtttgtaccagtgcgtggcttctaatgctattggaaccagcacctgtcttctggatctccaggttatttcaccccagcccaggaacattggactaatagctggagccattggcactggtgcagttattatcattttttgcattgcactaattttaggggcattcttttactggagaagcaaaaataaagaggaggaagaagaagaaattcctaatgaaataagagaggatgatcttccacccaagtgttcttctgccaaagcatttcacactgagatttcctcctcggacaacaacacactaacctcttccaatgcctacaacagtcgatactggagcaacaatccaaaagttcatagaaacacagagtcagtcagccacttcagtgacttgggccaatctttctctttccactcaggcaatgccaacataccatccatttatgctaatgggacccatctggtcccgggtcaacataagactctggtagtgacagccaacagagggtcatcaccacaggtgatgtccaggagcaatggctcagtcagtaggaagcctcggcctccacacactcattcctacaccatcagccacgcaacactggaacgaattggtgcagtacctgtcatggtaccagcccagagtcgggccgggtccttggtatag |
| Vector: | pDONR223 |
| Delivery lead time in business days in europe: | 10-12 days |
| Storage: | -20℃ |
| Delivery condition: | Blue Ice |
| Related products: | - chromosome 13 open reading frame 31 - adipose differentiation-related protein - chromosome 21 open reading frame 63 - sialic acid binding Ig-like lectin 9 |