C21orf63-chromosome 21 open reading frame 63 Gene View larger

C21orf63-chromosome 21 open reading frame 63 Gene

PTXBC038710

New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C21orf63-chromosome 21 open reading frame 63 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C21orf63-chromosome 21 open reading frame 63 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC038710
Product type: DNA & cDNA
Ncbi symbol: C21orf63
Origin species: Human
Product name: C21orf63-chromosome 21 open reading frame 63 Gene
Size: 2ug
Accessions: BC038710
Gene id: 59271
Gene description: chromosome 21 open reading frame 63
Synonyms: C21orf63; B18; B19; C21orf64; FAM176C; PRED34; SUE21; protein eva-1 homolog C; family with sequence similarity 176, member C; protein FAM176C; eva-1 homolog C
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcttctgccgggacgcgcacgccaaccgccgacgccccagcccgtgcagcatcacggcctccgccggcaggtagagccgccggggcagctcctgcgcctcttctactgcactgtcctggtctgctccaaagagatctcagcgctcaccgacttctctggttacctaaccaaactcctgcaaaaccacaccacctatgcctgtgatggggactatttgaatctacagtgccctcggcattctacgataagtgtccaatcggcattttatgggcaagattaccaaatgtgtagttcccagaagcctgcctcccagagggaagacagcttaacctgtgtggcagccaccaccttccagaaggtgctggacgaatgccagaaccagcgggcctgccacctcctggtcaatagccgtgtttttggacctgacctttgtccaggaagcagtaaatacctcctggtctcctttaaatgccaacctaatgaattaaaaaacaaaaccgtgtgtgaagaccaggagctgaaactgcactgccatgaatccaagttcctcaacatctactctgcgacctacggcaggaggacccaggaaagggacatctgctcctccaaggcagagcggctcccccctttcgattgcttgtcttactcagctttgcaagtcctatcccgaaggtgctatgggaagcagagatgcaaaatcatcgtcaacaatcaccattttggaagcccctgtttgccaggcgtgaaaaaatacctcactgtgacctacgcatgtgttcccaagaacatactcacagcgattgatccagccattgctaatctaaaaccttctttgaagcagaaagatggtataaacttcgacccaagcggatcgaaggttctgaggaaagatggaattcttgttagcaactctctggcagcctttgcttacattagagcccacccggagagagctgccctgctgttcgtgtccagtgtctgcatcggcctggccctcacactgtgcgccctggtcatcagagagtcctgtgccaaggacttccgcgacttgcagctggggagggagcagctggtgccaggaagtgacaaggtcgaggaggacagcgaggatgaagaagaggaggaggacccctctgagtctgatttcccaggggaactgtcggggttctgtaggacttcatatcctatatacagttccatagaagctgcagagctcgcagaaaggattgagcgcagggagcaaatcattcaggaaatatggatgaacagtggtttggacacctcgctcccaagaaacatgggccagttctactga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - sialic acid binding Ig-like lectin 9
- chromosome 6 open reading frame 211
- WD repeats and SOF1 domain containing
- chromosome 10 open reading frame 88

Buy C21orf63-chromosome 21 open reading frame 63 Gene now

Add to cart