Login to display prices
Login to display prices
SIGLEC9-sialic acid binding Ig-like lectin 9 Gene View larger

SIGLEC9-sialic acid binding Ig-like lectin 9 Gene

PTXBC035365

New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of SIGLEC9-sialic acid binding Ig-like lectin 9 Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about SIGLEC9-sialic acid binding Ig-like lectin 9 Gene

Proteogenix catalog: PTXBC035365
Ncbi symbol: SIGLEC9
Product name: SIGLEC9-sialic acid binding Ig-like lectin 9 Gene
Size: 2ug
Accessions: BC035365
Gene id: 27180
Gene description: sialic acid binding Ig-like lectin 9
Synonyms: CD329; CDw329; FOAP-9; OBBP-LIKE; siglec-9; sialic acid-binding Ig-like lectin 9; protein FOAP-9; sialic acid binding Ig like lectin 9
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagagttccgtgacggtgcaggaaggcctgtgtgtccatgtgccctgctccttctcctacccctcgcatggctggatttaccctggcccagtagttcatggctactggttccgggaaggggccaatacagaccaggatgctccagtggccacaaacaacccagctcgggcagtgtgggaggagactcgggaccgattccacctccttggggacccacataccgagaattgcaccctgagcatcagagatgccagaagaagtgatgcggggagatacttctttcgtatggagaaaggaagtataaaatggaattataaacatcaccggctctctgtgaatgtgacagccttgacccacaggcccaacatcctcatcccaggcaccctggagtccggctgcccccagaatctgacctgctctgtgccctgggcctgtgagcaggggacaccccctatgatctcctggatagggacctccgtgtcccccctggacccctccaccacccgctcctcggtgctcaccctcatcccacagccccaggaccatggcaccagcctcacctgtcaggtgaccttccctggggccagcgtgaccacgaacaagaccgtccatctcaacgtgtcctacccgcctcagaacttgaccatgactgtcttccaaggagacggcacagtatccacagtcttgggaaatggctcatctctgtcactcccagagggccagtctctgcgcctggtctgtgcagttgatgcagttgacagcaatccccctgccaggctgagcctgagctggagaggcctgaccctgtgcccctcacagccctcaaacccgggggtgctggagctgccttgggtgcacctgagggatgaagctgaattcacctgcagagctcagaaccctctcggctctcagcaggtctacctgaacgtctccctgcagagcaaagccacatcaggagtgactcagggggtggtcgggggagctggagccacagccctggtcttcctgtccttctgcgtcatcttcgttgtagtgaggtcctgcaggaagaaatcggcaaggccagcagcgggcgtgggagatacgggcatagaggatgcaaacgctgtcaggggttcagcctctcaggggcccctgactgaaccttgggcagaagacagtcccccagaccagcctcccccagcttctgcccgctcctcagtgggggaaggagagctccagtatgcatccctcagcttccagatggtgaagccttgggactcgcggggacaggaggccactgacaccgagtactcggagatcaagatccacagatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice

30 other products in the same category: