C19orf26-chromosome 19 open reading frame 26 Gene View larger

C19orf26-chromosome 19 open reading frame 26 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C19orf26-chromosome 19 open reading frame 26 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C19orf26-chromosome 19 open reading frame 26 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC028156
Product type: DNA & cDNA
Ncbi symbol: C19orf26
Origin species: Human
Product name: C19orf26-chromosome 19 open reading frame 26 Gene
Size: 2ug
Accessions: BC028156
Gene id: 255057
Gene description: chromosome 19 open reading frame 26
Synonyms: C19orf26; BARP; DOS; voltage-dependent calcium channel beta subunit-associated regulatory protein; VGCC beta-anchoring and -regulatory protein; calcium channel, voltage-dependent, beta subunit associated regulatory protein; downstream of Stk11; protein Dos; CACN beta subunit associated regulatory protein
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccacagccgccaccaccaccaccaccaccactgccacagtagccctgacgacgtcgtgggacaatgccactggacgccccacggcagagccagaccccatcctggacaactacgtgctgctggtggtggtgatgtcgctgttcgtggggggcacgctggtggtgttgtctggcgtcctgctcctctgcaagcgctgctgggacgtccaccagcgcctcaacagggccatggaggaagcggagaagaccaccaccacctacctggacaacggcacccacccagcccaagaccccgacttccggggagaggaccccgagtgccaggatgcggagaccgaacgcttcctgtccaccagctccacgggccgccgggtctccttcaatgaggcggcgctgtttgagcagagccgcaagacgcaggacaagggtcgccggtacacactgacggagggggacttccaccacctgaagaatgcccggctcacgcacctgcacctgccgcccctcaagattgtcaccatccacgagtgtgactcaggcgaggccagctcagccaccacgccccacccggccacctctcccaaggccactctggccatcttccagcccccggggaaggccctcaccggccgctctgtgggccccagctccgccctgccaggtgacccctacaactcagccgcgggcgccactgacttcgcagagatcagcccctcggcatctagcgactctggggaaggcaccttgttggatgccggtaccaggagcaccaaggctggagggcccggggctgcagcagggcctggggaggcgggcccgggatccggggcaggtaccgttctgcagttcctcacccgcctgcgccgccatgccagcctggatggggccagcccctatttcaaggtcaagaagtggaagctggagcccagccagcgggcagccagtctggacacgagaggttcccccaagcggcaccacttccagcggcagcgggcagccagtgagagcacggagcaggaggagggggatgccccccaggaggacttcatccagtacattgcccgggcgggcgacgccgtggccttcccgcgcccccgcccctttctggccagcccgccccctgctctcggcaggtatttttcagtagatggaggtgctaggggtggacctgtgggcccttgccccccttcgcccccccctaggcggcccagggagcgctctccaggccccgtggacacgcgctcgcctgcctccagcggcaaggcccctcccagaggcggactcactggggccacctctccagcatggaccagaggagggaagcagggagagactgggtaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - pancreatic lipase-related protein 1
- chromosome 12 open reading frame 66
- chromosome 7 open reading frame 28B
- chromosome 14 open reading frame 93

Buy C19orf26-chromosome 19 open reading frame 26 Gene now

Add to cart