C7orf28B-chromosome 7 open reading frame 28B Gene View larger

C7orf28B-chromosome 7 open reading frame 28B Gene

PTXBC010130

New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C7orf28B-chromosome 7 open reading frame 28B Gene

BrandProteoGenix
Product typeDNA & cDNA
Origin speciesHuman

More info about C7orf28B-chromosome 7 open reading frame 28B Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC010130
Product type: DNA & cDNA
Ncbi symbol: C7orf28B
Origin species: Human
Product name: C7orf28B-chromosome 7 open reading frame 28B Gene
Size: 2ug
Accessions: BC010130
Gene id: 221960
Gene description: chromosome 7 open reading frame 28B
Synonyms: C7orf28B; H_NH0577018.2; vacuolar fusion protein CCZ1 homolog B; CCZ1 homolog, vacuolar protein trafficking and biogenesis associated B; CCZ1 vacuolar protein trafficking and biogenesis associated B; CCZ1 vacuolar protein trafficking and biogenesis associated homolog B; H_DJ1163J12.2; CCZ1 homolog B, vacuolar protein trafficking and biogenesis associated
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggctgcagcggcggccggggccgggagcgggccctgggcggcccaggagaagcagttcccgccggcgctgctgagtttcttcatctacaacccgcgcttcgggccgcgcgaaggacaggaggaaaataagattttattttatcatccaaatgaggtagaaaagaatgagaagattagaaatgtcggattgtgtgaagctattgtacagtttacaaggacatttagcccatcaaaacctgcaaaatctttacatacacagaagaacagacagttcttcaatgaaccagaagaaaatttctggatggtcatggttgttcggaatcctataattgaaaaacagagtaaagatggaaaaccagttattgaatatcaagaggaggagttgttggacaaggtttatagctcggtgctgcggcagtgctacagcatgtacaagctttttaatggtacatttctgaaagccatggaagacggaggcgtcaagcttctgaaagaaagattagagaaattcttccatcggtatttgcaaacgctacatttgcagtcatgtgacctacttgacatttttggtggaatcagcttcttcccgttggataaaatgacttatttgaaaatccagtcctttattaatagaatggaggaaagcctgaatatagtcaaatacactgcttttctctataacgatcagctcatctggagtggattagaacaagatgacatgagaattttatacaaataccttaccacctcccttttcccaaggcacatcgaacctgagttagcaggaagggattctccaataagagcagaaatgccaggaaatcttcaacactatggaagatttcttaccggacccttgaacctcaatgatccagatgcaaaatgcagattccccaaaatttttgtaaatacagatgacacttatgaagagctccatttaatcgtttataaggccatgagtgcggctgtgtgctttatgatcgacgcctctgtccacccaacgttggatttttgccgaagactggacagcatcgttgggccccagctcacagtgctggcctctgacatctgtgaacagtttaacatcaacaagaggatgtctgggtctgagaaagaaccccagtttaagtttatctacttcaaccacatgaatctcgccgagaagagcacagttcacatgaggaaaacgcccagcgtgtcgctcacttccgtgcacccggatttaatgaagattctcggtgacatcaacagtgactttaccagagtggatgaagatgaggagatcattgtgaaggccatgagtgattactgggttgttggaaagaagtctgatcggcgggagctctatgttattttgaatcaaaaaaatgcaaacctgattgaagtaaatgaagaggtcaagaaactttgtgcaacgcagttcaacaacatcttcttcttggattga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - chromosome 14 open reading frame 93
- protein inhibitor of activated STAT, 4
- chromosome 15 open reading frame 44
- chromosome 16 open reading frame 71

Buy C7orf28B-chromosome 7 open reading frame 28B Gene now

Add to cart