C13orf31-chromosome 13 open reading frame 31 Gene View larger

C13orf31-chromosome 13 open reading frame 31 Gene


New product

121,50 € tax excl.

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of C13orf31-chromosome 13 open reading frame 31 Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about C13orf31-chromosome 13 open reading frame 31 Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC035749
Product type: DNA & cDNA
Ncbi symbol: C13orf31
Origin species: Human
Product name: C13orf31-chromosome 13 open reading frame 31 Gene
Size: 2ug
Accessions: BC035749
Gene id: 144811
Gene description: chromosome 13 open reading frame 31
Synonyms: C13orf31; FAMIN; laccase domain-containing protein 1; fatty acid metabolism-immunity nexus; laccase (multicopper oxidoreductase) domain containing 1; laccase domain containing 1
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggcagaagctgttttgattgatctttttggtttgaaattgaactctcaaaaaaactgccatcagacattactgaagactttgaatgctgtccaataccaccatgctgccaaggccaagtttctctgtataatgtgttgcagtaacatcagctatgaaagggatggagaacaagataattgtgaaatagaaacaagcaatggattatcagctctcttggaagaatttgagattgttagctgtcccagcatggctgccactttgtataccattaaacagaaaattgatgaaaaaaatctgagcagcattaaggtaattgtacccaggcacaggaagacattaatgaaagcttttattgatcaactcttcacagatgtttacaattttgaatttgaagatttgcaagtgacttttaggggagggctttttaaacagtccattgaaataaacgtaatcacagctcaagaactaagaggaattcagaatgaaatagaaacatttttgagaagtctgccagcactgagaggaaaattaactattatcacttcttctttgatcccagatattttcatacatggatttactacaagaacaggtgggatatcttatataccaactcttagctcattcaatctcttcagtagttccaaacggagagatcccaaggtagtggttcaagaaaatctgcgtaggttggcgaatgctgcaggatttaatgtggagaaattttaccgaataaagactcatcattccaatgacatctggattatgggaagaaaggagcctgactcttatgatggaataaccacaaatcagagaggagtcacaatagcagctcttggtgcagactgtataccgatagtttttgcagatccagtcaaaaaagcatgtggggttgctcacgctggttggaaaggtactttgttgggtgttgctatggctacagtgaatgctatgatagcagaatatggctgcagtttggaagacattgttgttgtacttggaccttcagtaggaccttgctgttttactcttccaagggaatcagcagaggcatttcataatcttcatcctgcatgtgtacaactatttgattcaccaaatccctgtatcgacatccgtaaagccacaaggattcttctagaacagggaggaattcttccacagaatattcaggaccagaaccaagatctcaacctctgtacatcttgccatcctgacaagtttttctcccatgtccgagatggccttaattttggtacacagattggcttcatatcaattaaagaatga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - adipose differentiation-related protein
- chromosome 21 open reading frame 63
- sialic acid binding Ig-like lectin 9
- chromosome 6 open reading frame 211

Buy C13orf31-chromosome 13 open reading frame 31 Gene now

Add to cart