Login to display prices
Login to display prices
ACADL-acyl-Coenzyme A dehydrogenase, long chain Gene View larger

ACADL-acyl-Coenzyme A dehydrogenase, long chain Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of ACADL-acyl-Coenzyme A dehydrogenase, long chain Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about ACADL-acyl-Coenzyme A dehydrogenase, long chain Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC039063
Product type: DNA & cDNA
Ncbi symbol: ACADL
Origin species: Human
Product name: ACADL-acyl-Coenzyme A dehydrogenase, long chain Gene
Size: 2ug
Accessions: BC039063
Gene id: 33
Gene description: acyl-Coenzyme A dehydrogenase, long chain
Synonyms: ACAD4; LCAD; long-chain specific acyl-CoA dehydrogenase, mitochondrial; acyl-Coenzyme A dehydrogenase, long chain; acyl-CoA dehydrogenase, long chain
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atggccgcacgccttctccgagggtccctacgcgtcctgggcggccaccgtgcgccgcgccagctgcccgccgcgcgatgttctcattccggaggggaagaacgtctagaaactccttctgctaaaaaattaacagatataggaattcgaagaatcttttctccagagcatgacattttccggaaaagtgtaaggaagtttttccaagaagaagtgattcctcatcactcagaatgggagaaagctggagaagtaagtagggaggtttgggaaaaagctggaaaacaaggactgcttggtgtcaatattgcagagcatcttggtggaattggaggggatctgtactccgcagctattgtctgggaggagcaagcttattcaaattgttcaggcccaggttttagtattcattcaggtattgtcatgtcctatattacaaaccatggctcagaagaacagattaagcactttattccccagatgactgcaggcaaatgtattggtgcaatagcaatgacagagcctggagctggaagtgacttacagggaataaaaacaaatgctaaaaaggatggaagtgactggattctcaatggaagcaaggtgttcatcagtaatgggtcattaagtgatgttgtgattgtagttgcggtcacaaatcatgaagctccctcccctgcccatggtattagcctttttctggtggaaaatggaatgaaaggatttatcaagggacgaaagctacataaaatgggattaaaagcccaggataccgcagaactattctttgaagatatacggttgccagctagtgccctacttggagaagagaataaaggcttctattacatcatgaaagagcttccacaggaaaggctgttaattgctgatgtggcaatttcagctagtgaattcatgtttgaagaaaccaggaactatgttaaacaaagaaaagcttttggcaaaacagttgctcacctacagacagtgcaacataaattagcagaattaaaaacacatatatgtgtaacccgagcatttgtggacaactgtctccagctgcatgaagcgaaacgtttggactccgccactgcttgcatggcgaaatattgggcatctgagttacaaaatagtgtagcttacgactgtgtacagctccatggaggttggggatacatgtgggagtacccaattgcaaaagcttatgtggatgccagagttcagccaatctatggtggtacaaatgaaataatgaaggagctgattgcaagagagattgtctttgacaagtag
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - eukaryotic translation initiation factor 5
- zinc finger and BTB domain containing 25
- F-box and leucine-rich repeat protein 20
- ornithine aminotransferase (gyrate atrophy)