OAT-ornithine aminotransferase (gyrate atrophy) Gene View larger

OAT-ornithine aminotransferase (gyrate atrophy) Gene


New product

121,50 €

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of OAT-ornithine aminotransferase (gyrate atrophy) Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about OAT-ornithine aminotransferase (gyrate atrophy) Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC000964
Product type: DNA & cDNA
Ncbi symbol: OAT
Origin species: Human
Product name: OAT-ornithine aminotransferase (gyrate atrophy) Gene
Size: 2ug
Accessions: BC000964
Gene id: 4942
Gene description: ornithine aminotransferase (gyrate atrophy)
Synonyms: GACR; HOGA; OATASE; OKT; ornithine aminotransferase, mitochondrial; gyrate atrophy; ornithine delta-aminotransferase; ornithine-oxo-acid aminotransferase; testicular tissue protein Li 130
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgttttccaaactagcacatttgcagaggtttgctgtacttagtcgcggagttcattcttcagtggcttctgctacatctgttgcaactaaaaaaacagtccaaggccctccaacctctgatgacatttttgaaagggaatataagtatggtgcacacaactaccatcctttacctgtagccctggagagaggaaaaggtatttacttatgggatgtagaaggcagaaaatattttgacttcctgagttcttacagtgctgtcaaccaagggcattgtcaccccaagattgtgaatgctctgaagagtcaagtggacaaattgaccttaacatctagagctttctataataacgtacttggtgaatatgaggagtatattactaaacttttcaactaccacaaagttcttcctatgaatacaggagtggaggctggagagactgcctgtaaactagctcgtaagtggggctataccgtgaagggcattcagaaatacaaagcaaagattgtttttgcagctgggaacttctggggtaggacgttgtctgctatctccagttccacagacccaaccagttacgatggttttggaccatttatgccgggattcgacatcattccctataatgatctgcccgcactggagcgtgctcttcaggatccaaatgtggctgcgttcatggtagaaccaattcagggtgaagcaggcgttgttgttccggatccaggttacctaatgggagtgcgagagctctgcaccaggcaccaggttctctttattgctgatgaaatacagacaggattggccagaactggtagatggctggctgttgattatgaaaatgtcagacctgatatagtcctccttggaaaggccctttctgggggcttataccctgtgtctgcagtgctgtgtgatgatgacatcatgctgaccattaagccaggggagcatgggtccacatacggtggcaatccactaggctgccgagtggccatcgcagcccttgaggttttagaagaagaaaaccttgctgaaaatgcagacaaattgggcattatcttgagaaatgaactcatgaagctaccttctgatgttgtaactgccgtaagaggaaaaggattattaaatgctattgtcattaaagaaaccaaagattgggatgcttggaaggtgtgtctacgacttcgagataatggacttctggccaagccaacccatggcgacattatcaggtttgcgcctccgctggtgatcaaggaggatgagcttcgagagtccattgaaattattaacaagaccatcttgtctttctga
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - zinc finger and BTB domain containing 26
- TERF1 (TRF1)-interacting nuclear factor 2
- cholinergic receptor, nicotinic, alpha 5
- non-POU domain containing, octamer-binding

Buy OAT-ornithine aminotransferase (gyrate atrophy) Gene now

Add to cart