Login to display prices
Login to display prices
NONO-non-POU domain containing, octamer-binding Gene View larger

NONO-non-POU domain containing, octamer-binding Gene


New product

Customer ratings and reviews

Nobody has posted a review yet
in this language

Data sheet of NONO-non-POU domain containing, octamer-binding Gene

Product typeDNA & cDNA
Origin speciesHuman

More info about NONO-non-POU domain containing, octamer-binding Gene

Brand: ProteoGenix
Proteogenix catalog: PTXBC002364
Product type: DNA & cDNA
Ncbi symbol: NONO
Origin species: Human
Product name: NONO-non-POU domain containing, octamer-binding Gene
Size: 2ug
Accessions: BC002364
Gene id: 4841
Gene description: non-POU domain containing, octamer-binding
Synonyms: MRXS34; NMT55; NRB54; P54; P54NRB; PPP1R114; non-POU domain-containing octamer-binding protein; 54 kDa nuclear RNA- and DNA-binding protein; 55 kDa nuclear protein; DNA-binding p52/p100 complex, 52 kDa subunit; non-POU domain-containing octamer (ATGCAAAT) binding protein; p54(nrb); protein phosphatase 1, regulatory subunit 114; non-POU domain containing, octamer-binding
Sequence primers: Forward primer M13R (5'→3'): GTAAAACGACGGCCAGT Reverse primer T7P (5'→3'): TAATACGACTCACTATAGG
Orf sequence: atgcagagtaataaaacttttaacttggagaagcaaaaccatactccaagaaagcatcatcaacatcaccaccagcagcagcaccaccagcagcaacagcagcagccgccaccaccgccaatacctgcaaatgggcaacaggccagcagccaaaatgaaggcttgactattgacctgaagaattttagaaaaccaggagagaagaccttcacccaacgaagccgtctttttgtgggaaatcttcctcccgacatcactgaggaagaaatgaggaaactatttgagaaatatggaaaggcaggcgaagtcttcattcataaggataaaggatttggctttatccgcttggaaacccgaaccctagcggagattgccaaagtggagctggacaatatgccactccgtggaaagcagctgcgtgtgcgctttgcctgccatagtgcatcccttacagttcgaaaccttcctcagtatgtgtccaacgaactgctggaagaagccttttctgtgtttggccaggtagagagggctgtagtcattgtggatgatcgaggaaggccctcaggaaaaggcattgttgagttctcagggaagccagctgctcggaaagctctggacagatgcagtgaaggctccttcctgctaaccacatttcctcgtcctgtgactgtggagcccatggaccagttagatgatgaagagggacttccagagaagctggttataaaaaaccagcaatttcacaaggaacgagagcagccacccagatttgcacagcctggctcctttgagtatgaatatgccatgcgctggaaggcactcattgagatggagaagcagcagcaggaccaagtggaccgcaacatcaaggaggctcgtgagaagctggagatggagatggaagctgcacgccatgagcaccaggtcatgctaatgagacaggatttgatgaggcgccaagaagaacttcggaggatggaagagctgcacaaccaagaggtgcaaaaacgaaagcaactggagctcaggcaggaggaagagcgcaggcgccgtgaagaagagatgcggcggcagcaagaagaaatgatgcggcgacagcaggaaggattcaagggaaccttccctgatgcgagagagcaggagattcggatgggtcagatggctatgggaggtgctatgggcataaacaacagaggtgccatgccccctgctcctgtgccagctggtaccccagctcctccaggacctgccactatgatgccggatggaactttgggattgaccccaccaacaactgaacgctttggtcaggctgctacaatggaaggaattggggcaattggtggaactcctcctgcattcaaccgtgcagctcctggagctgaatttgccccaaacaaacgtcgccgatactaa
Vector: pDONR223
Delivery lead time in business days in europe: 10-12 days
Storage: -20℃
Delivery condition: Blue Ice
Related products: - peptidase (mitochondrial processing) beta
- cholinergic receptor, nicotinic, alpha 6
- DEAH (Asp-Glu-Ala-His) box polypeptide 30
- fibroblast growth factor receptor-like 1